We narrowed to 15,760 results for: LIS
-
Plasmid#158576PurposeFor targeted insertion of V5-HA-2A-Luciferase reporter before the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInserthuman SLC12A5 5' homology arm-V5-HA-2A-Luciferase-3' homology arm (SLC12A5 Human)
TagsV5 and HA on the endogenous KCC2 protein productExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-1.03kb-EGFP
Plasmid#153164PurposeTruncated mouse gamma-synuclein (mSncg-1.03kb) promoter-mediates gene expression in mammalian retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Dbh HMEJ donor
Plasmid#97320PurposeHMEJ donor for fusing a p2A-mCherry-WPRE reporter to mouse Dbh. AAV backbone.DepositorInsertDbh HMEJ donor
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM4663
Plasmid#85126PurposeNSIII -Cm-PkaiB-luc+ (firefly) vector constructed by seamless cloning with Cm casette codon optimized for S7942. PkaiB-luc+ amplified from pAM2105.DepositorInsertPkaiB-luciferase
ExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
hum alpha ENAC promoter a25-a23
Plasmid#83427Purposepromoter reporter construct to test 5' flanking sequencesDepositorInserthuman aENaC gene 5' flanking seq + 55 nt of the 5' UTR for exon 1A (SCNN1A Human)
UseLuciferaseTagsLuciferasePromoteralpha ENACAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSETC-RdgBbeta-splice variant 1
Plasmid#58276Purposebacterial expression of human RdgBbeta splice variant 1DepositorAvailable SinceAug. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
Ai140 (TIT2L-GFP-ICL-tTA2) targeting vector
Plasmid#114427PurposeTarget a Cre-dependent GFP and a tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tTA2
UseCre/Lox and Mouse TargetingExpressionMammalianPromoterPGK, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-basic-FTO promoter_Mut
Plasmid#108923PurposeThe core promoter region of FTO with mutant CEBPA binding sites was inserted into pGL3 basic vectorDepositorAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tapasin-TM
Plasmid#254045Purposepsffv-tapasin-TM-FLAGDepositorInsertTapasin-TM (TAPBP Human)
UseLentiviralTagsFLAG TagExpressionMammalianMutationremoved C terminal domain, replaced with that of …PromotersffvAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTW2658
Plasmid#252576PurposeTRV2 multiplex vector expressing Ymu1-WFR, AtCHLl1 gRNA4 and AtPDS3 gRNA12DepositorInsertYmu1-WFR with AtCHLl1 gRNA4 and AtPDS3 gRNA12
UseCRISPRExpressionPlantAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTW2657
Plasmid#252577PurposeTRV2 multiplex vector expressing Ymu1-WFR, AtPDS3 gRNA12 and AtCHLl1 gRNA4DepositorInsertYmu1-WFR with AtPDS3 gRNA 12 and AtCHLl1 gRNA4
UseCRISPRExpressionPlantAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTW2684
Plasmid#252585Purposeccdb dropout cloning vector for PaqCI Golden Gate assembly of Ymu1-WFR guides into TRV2DepositorInsertYmu1-WFR with ccdb
ExpressionPlantAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
YY229: pAAV_TRE::GFP- GEMINI(A)-P1N4_hSyn::rtTA3G
Plasmid#228889PurposeAAV plasmid expressing the destabilized GFP-GEMINI(A) under the control of a doxycycline-inducible promotor, and rtTA3G under the control of a hSyn promotorDepositorInsertGFP-GEMINI(A); rtTA3G
UseAAVTagsgfpPromoterTRE; hsynAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD0056_pIVTRup_dCas9-VP64
Plasmid#242542PurposeIVTDepositorInsertdCas9-VP64
UseCRISPRMutationD10AAvailable SinceNov. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-TdTomato-miR122
Plasmid#244909PurposeAAV transgene plasmid encoding TdTomato with miR-122 target siteDepositorInsertTdTomato
UseAAVAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only