We narrowed to 13,244 results for: BASE;
-
Plasmid#168469PurposeFor the insertion pf NLS-mScarlet-I-H-NSdbd-NLS into the chromosome of a eukaryotic cell line carrying the Flp-IN/T-Rex systemDepositorInsertNLS-mScarlet-I-H-NSdbd-NLS
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H171
Plasmid#170353PurposemTurq2Del_EPACdDEPCD_Q270E_cp173Ven(ST)_Ven(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmTurq2Del_EPACdDEPCD_Q270E_cp173Ven(ST)_Ven(ST) (RAPGEF3 Human)
UseAdenoviralExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPGK-T7/2-CD44v2-10 (-cyt)
Plasmid#137825Purposeexpression of CD44 proteins in mammalian cellsDepositorInsertCD44v2-10 (-cyt) (CD44 Human)
TagsGFPExpressionMammalianMutationwithout cytoplasmic region - N213S on the CD44 re…PromoterPGKAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26-1gRNA-DFR 2.1 (GB1838)
Plasmid#160625PurposeGB-cassette for the expression of a guide RNA targeting the DFR promoter with 2.1 Ms2 aptamer in the 3' of the scaffoldDepositorInsertU6-26-1gRNA-DFR 2.1
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3c_SUD-C
Plasmid#156471PurposeBacterial expression of Sars-CoV2 Nsp3c_SUD-C protein with His-tag and GST-tagDepositorInsertNsp3c_SUD-C (ORF1ab Synthetic)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM33_Nsp3e_NAB
Plasmid#156473PurposeBacterial expression of Sars-CoV2 Nsp3e_NAB protein with His-tag and GST-tagDepositorInsertNsp3e_NAB (ORF1ab Synthetic, Severe acute respiratory syndrome coronavirus 2)
TagsHis-GSTExpressionBacterialMutationGene insert is codon optimized for Ecoli.PromoterT7/LacOAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA901: pMVP (L3-L2) HA tag + pA; EF1a::eGFP-P2A-TETa-pA
Plasmid#121804PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + EF1a-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream EF1a-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + EF1a::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA701: pMVP (L3-L2) HA tag + pA; RIP::eGFP-P2A-TETa-pA
Plasmid#121808PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + RIP-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream RIP-driven GFP-P2A-TETaDepositorInsertHA epitope tag-polyA + RIP::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-GFP-PGK-Puro
Plasmid#110862PurposeLentiviral vector for constitutive expression of Cas9-VRER-P2A-GFP (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-GFP-PGK-Puro
Plasmid#110863PurposeLentiviral vector for constitutive expression of Cas9-HF1-P2A-GFP (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
HS1BP3-PX (17-139)
Plasmid#119125PurposeBacterial expression of human phox homology (PX) domain, HS1BP3-PX (17-139)DepositorAvailabilityAcademic Institutions and Nonprofits only -
N-term AAV-ABE8e-SpCas9(S55R) (CA21)
Plasmid#242659PurposeCBh promoter expression plasmid for N-terminal intein-split AAV construct with N-term of ABE8e-SpCas9(S55R) - to be used with eVRQR constructsDepositorInsertpAAV-pCBh-BPNLS(SV40)-TadA8e-gs-SpCas9(D10A;S55R)-[N-term]-NpuN-BPNLS(SV40)-WPRE-bGH_PA
UseAAV and CRISPRTagsBPNLS and NpuN(intein)-BPNLSMutationSpCas9(S55R)PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_NEmut (AAV9)
Viral Prep#123310-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_NEmut (#123310). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_NEmut plasmid DNA. hSyn-driven expression of GRAB-NEmut control norepinephrine sensor (does not respond to NE). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only