We narrowed to 3,401 results for: aaas
-
Plasmid#227467Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 26kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-7-12
Plasmid#227471Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-hcr5
Plasmid#193661PurposeExpression of tandem pre-sgRNA array hcr5 for LbCas12aDepositorInsertU6-DNMT3B-sgRNA-KLF4-sgRNA-TET1-sgRNA-PRR5L-sgRNA-CFTR-sgRNA-tRNA
ExpressionMammalianPromoterU6Available SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
NIM1K gRNA (BRDN0001145390)
Plasmid#77271Purpose3rd generation lentiviral gRNA plasmid targeting human NIM1KDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGM2L1 gRNA (BRDN0001147006)
Plasmid#77147Purpose3rd generation lentiviral gRNA plasmid targeting human PGM2L1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RBKS gRNA (BRDN0001145714)
Plasmid#77040Purpose3rd generation lentiviral gRNA plasmid targeting human RBKSDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TEX14 gRNA (BRDN0001147636)
Plasmid#76834Purpose3rd generation lentiviral gRNA plasmid targeting human TEX14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA2
Plasmid#223520PurposeKnocking out hGSDME in human cellsDepositorAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001145338)
Plasmid#77699Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001146381)
Plasmid#77701Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAR2B gRNA (BRDN0001147315)
Plasmid#76151Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROS_phleo-Tps1/Gsy2
Plasmid#196612PurposeEncoding guide RNAs for the knock out of TPS1 and GSY2 genesDepositorAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
RIOK1 gRNA (BRDN0001148912)
Plasmid#77659Purpose3rd generation lentiviral gRNA plasmid targeting human RIOK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LADL Bridge + Promoter Only Target
Plasmid#127669PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYO1300
Plasmid#235741PurposeExpression of VPS34 (REIE to AAAA)_FL - EGFP in mammalian cellsDepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-mSAT
Plasmid#181908PurposeSingle guide RNA with 2XMS2 loops targeting mouse major satellite repeatsDepositorInsertsgRNA-2XMS2-mSAT
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only