We narrowed to 17,862 results for: crispr grnas
-
Plasmid#216471Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2703-AGER-gRNA2
Plasmid#216472Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2704-AGER-gRNA3
Plasmid#216473Purposeto express Cas9 from S. pyogenes with 2A-eGFP and sgRNA targeting human AGER endogenous ATG start siteDepositorInsertsgRNA targeting human AGER locus
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-CRY2-#1
Plasmid#189989PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hCRY2, works with Addgene 189983-189986DepositorInsertCryptochrome-2 (CRY2 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-lacO
Plasmid#181909PurposeSingle guide RNA with 2XMS2 loops targeting bacterial lac operatorDepositorInsertsgRNA-2XMS2-lacO
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-mSAT
Plasmid#181908PurposeSingle guide RNA with 2XMS2 loops targeting mouse major satellite repeatsDepositorInsertsgRNA-2XMS2-mSAT
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK002_U6-Sa-sgRNA(mod)_EFS-SaCas9-2A-Puro_WPRE
Plasmid#85452PurposeLentiviral vector encoding modified SaCas9 system backbone bearing BsmBI site for new guide RNAs and puromycin selection marker.DepositorInsertU6-modified-sgRNA-Backbone-EFS-hSaCas9-2xNLS-2A-Puro
UseCRISPR and LentiviralTagsNLSExpressionMammalianAvailable SinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-SpRY[C-term]-gRNAentry (CA20)
Plasmid#197511PurposeCbh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpRY and BsmBI entry cassette to clone SpCas9 gRNA spacerDepositorInsertAAV-[ITR]-pCbh-BPNLS-NpuC-SpRY[C-term]-BPNLS-gRNA[BsmBI]-pU6-[ITR]
UseAAV and CRISPRTagsBPNLS and BPNLS-NpuC(intein)MutationC-terminal mutations of SpRY(L1111R/D1135L/S1136W…PromoterCbhAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRainbow-DONOR1
Plasmid#75398PurposeCRISPRainbow-DONOR1DepositorInsertCm(R)-CcdB
UseCRISPRTagsnoPromoterBacteriaAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459_MCM2_sgRNA
Plasmid#232730PurposeGenerates MCM2 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_CDC45_sgRNA
Plasmid#232732PurposeGenerates CDC45 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMB2_sgRNA_1
Plasmid#155092Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMB2 (core essential gene)DepositorInsertPSMB2_sgRNA_1 (PSMB2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_PSMD1_sgRNA_1
Plasmid#155091Purposelentiviral plasmid expressing Cas9 and gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_PSMD1_sgRNA_1
Plasmid#155107Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting PSMD1 (core essential gene)DepositorInsertPSMD1_sgRNA_1 (PSMD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
lenti-gRNA
Plasmid#226867PurposeLentiviral expression of Sp-gRNA with BlpI and BstXI restriction sites for gRNA spacer cloning. Also expresses BFP.DepositorInsertLenti Sp-gRNA
UseLentiviralPromotermU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
px330BRG1 gRNA
Plasmid#165585PurposeInsertion of BRG1 degronDepositorAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-Cas9 UPF1 sgRNA
Plasmid#251491PurposeCas9 CRISPR gRNA construct; expresses human UPF1 gRNADepositorInsertUPF1 gRNA
ExpressionBacterialAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAVi U6_gRNA CMV_SadCas9-KRAB
Plasmid#214609PurposeAll-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassetteDepositorInsertsgRNA
SadCas9
UseAAVTagsNP NLS and SV40 NLSExpressionMammalianMutationD10A, N580APromoterCMV and U6Available SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only