We narrowed to 16,015 results for: grn
-
Plasmid#188547PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid L101DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPExpressionMutationPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p204-U6-Switch-ON
Plasmid#217883PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralTagsExpressionMammalianMutationPromoterhU6Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgLMNA
Plasmid#170546PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of LMNA
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-A
Plasmid#207823PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pML45
Plasmid#206995PurposeContains gRNA targeting mouse Ptbp1 gene and Cas9 ORF.DepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
UseTagsExpressionPlantMutationPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
UseTagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
UseTagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
UseTagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgUroD v4
Plasmid#158036Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse UroDDepositorInsertUroD sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceOct. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO-Cre sgItgb5 v3
Plasmid#158038Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA against mouse Itgb5DepositorInsertItgb5 sgRNA
UseTagsExpressionMammalianMutationPromoterU6Available SinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits