We narrowed to 9,345 results for: yeast expression
-
Plasmid#133896PurposePositive control when used with pMS22H-IRE. Expression of Gal4AD-IRP hybrid protein. Homology regions for recombination with pMS22HDepositorInsertIRP
ExpressionYeastPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS-ATG1-ATG7 3'UTR(406)
Plasmid#122070PurposeExpressing ATG1 with ATG7 3'UTRDepositorInsertserine/threonine protein kinase ATG1 (ATG1 Budding Yeast)
ExpressionYeastMutationThe native 3'UTR was replaced by ATG7 3'…Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCu-GFP-Atg17(416)
Plasmid#121408PurposeExpressing GFP-Atg17DepositorInsertCUP1p-GFP-ATG17 ORF-CYC1 terminator
ExpressionYeastPromoterCUP1 promoterAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCu-Atg17(416) (F317D)
Plasmid#121406PurposeExpressing Atg17DepositorInsertCUP1p-ATG17 ORF-CYC1 terminator
ExpressionYeastMutationPhenylalanine 317 to Aspartic acidPromoterCUP1 promoterAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCu-Atg17(416) (I325D)
Plasmid#121407PurposeExpressing Atg17DepositorInsertCUP1p-ATG17 ORF-CYC1 terminator
ExpressionYeastMutationIsoleucine 325 to Aspartic acidPromoterCUP1 promoterAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
p415TEF-NYFP
Plasmid#99555PurposeExpresses Swi1 NQ-YFP to monitor Swi1 state or induce [SWI+].DepositorAvailable SinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pWHI2-HYG
Plasmid#80589PurposeCEN plasmid expressing full-length WHI2 from S.cerevisiae S288C background under its native promoterDepositorAvailable SinceJuly 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYES2-gRNA-hyg-MCS
Plasmid#107734PurposeE. coli-S. cerevisiae shuttle plasmid harbors gRNA expression cassettes targeting S. cerevisiae chromosomal X-3 site (HXK1 gene). Can function as a gRNA expression empty backbone plasmid.DepositorInsertX-3 site gRNA expression cassettes
UseCRISPRExpressionYeastPromoterSNR52pAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
TDH3pro-rtTA-tetO7pro-T7pol-pRS413
Plasmid#239293PurposeExpresses the reverse tetracycline activator (rtTA) and T7 polymerase; Plasmid #1 of the tet-on overexpression systemDepositorInsertsT7 polymerase with NLS and P278L
reverse tetracycline transactivator (rtTA)
ExpressionYeastMutationContains M2-SE-G72P mutations, described in Addge…PromoterTDH3 and tetracycline-responsive element (TRE) an…Available SinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTRW10K_0x5
Plasmid#177278Purposegenomic integration of genes (inserted in I-SceI-site) via transposon Tn5DepositorTypeEmpty backboneUseSynthetic Biology; Yeast expression, tn5 genomic …ExpressionBacterialAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCL475
Plasmid#219503PurposeExpress Ade2, Can1 and Faa1 retron msd donor-gRNAs from a single Gal7 promoter, separated by a Csy4 recognition sequence, with an msr expressed in transDepositorInsertAde2, Can1 and Faa1 retron msd donor-gRNAs separated by a Csy4 recognition sequence, with an msr expressed in trans
ExpressionYeastPromoterGAL7Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pITESceIcmd
Plasmid#218288PurposeIntroduction of a cyanamide-inducible I-SceI expression cassette, use in combination with pITEdv1DepositorInsertHO(-253, -1)-tSynth3ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-ATG8(416)/GFP-AUT7(416)
Plasmid#49425PurposeExpresses ATG8 fused at the N terminus to GFP under the control of the endogenous promoter in the pRS416 vector.DepositorInsertautophagy-related 8 (ATG8 Budding Yeast)
TagsGFPExpressionBacterial and YeastPromoterATG8Available SinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDIV515
Plasmid#177703PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas3-APOBEC1
Plasmid#229536PurposepMV_hyg encoding Cas3(wt)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
Cas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas3-CDA1
Plasmid#229534PurposepMV_hyg encoding Cas3(wt)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH3mCHSH2
Plasmid#101053PurposeThis is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.DepositorInsertCryptococcus mCherry expression plasmid
ExpressionYeastPromoterCryptococcus Histone3 promoterAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only