We narrowed to 61,159 results for: tro
-
Plasmid#239082PurposeGal4 activated transgene expression of positive-going voltage sensor under the hsp70 promoter in D. melanogasterDepositorInsertPositron2
ExpressionInsectMutationR78K N81D D92N W178FPromoterhsp70Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
T7pro-tRNA-ITSIle intron-T7tVar1-pRS426
Plasmid#239294PurposeExpresses the tRNAIle intron bearing the 5' GGGAGA initially transcribed sequence (ITS); Plasmid #2 of the tet-on overexpression systemDepositorInsertsT7 promoter
ITS-tRNAIle intron
T7 terminator - Var1
ExpressionYeastAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM1 WPRE
Plasmid#236233PurposeAAV expression of mouse STIM1 internally tagged with HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Sec61b WPRE
Plasmid#236229PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mScarlet-STIM2 WPRE
Plasmid#236236PurposeAAV expression of human STIM2 internally tagged with mScarlet-IDepositorInsertmScarletI-STIM2 (STIM2 Human)
UseAAVTagsmScarletI in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-Sec61b WPRE
Plasmid#236228PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to mEmerald.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-STIM2 WPRE
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29MutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW368 CMV-TO-UtroUpZF-deImmunLink-NZF(FLP-IN)
Plasmid#236154PurposePlasmid encoding the UtroUp zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUtroUpZF-deImmunLink-NZF
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta human
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2085-WT-GPA-NLuc-Biosensor-Retrovirus-TD135
Plasmid#222875PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). WT Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(WT)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianPromoterMSCV LTRAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein with Nluc tagged E2
Plasmid#215699PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-NLucE2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-NLucE2-6K-E1
ExpressionMammalianPromoterCMVAvailable SinceAug. 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRetroX-TRE3G-GMIP P363D P364D P366D
Plasmid#221323PurposeDox-inducible expression of GMIP mutant in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53-T2A-Rac1(G12V)
Plasmid#221330PurposeDox-inducible expression of FLAG-IRSp53-T2A-HA-Rac1 G12V in mammalian cells by retroviral transductionDepositorUseRetroviralMutationG12VPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TetOne-Puro-p62 K7A/D69A
Plasmid#204549PurposeExpresses p62 K7A/D69A in a doxycycline-dependent manner in mammalian cellsDepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
SVA-lncRNA AK057321 shRNA 1A scramble control
Plasmid#202835PurposeLentiviral vector that expresses a scrambled control shRNA for SVA-lncRNA AK057321 shRNA 1ADepositorInsertpLVX-SVA-lncRNA shRNA 1A scramble control
UseLentiviralExpressionMammalianPromoterU6Available SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only