We narrowed to 38,624 results for: Spr
-
Plasmid#124803PurposeHDR template to knock-in mouse IgG2a Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2a producing cell lines.DepositorInsertMurine IgG2a
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG2b-srt-his
Plasmid#124804PurposeHDR template to knock-in mouse IgG2b Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG2b producing cell lines.DepositorInsertMurine IgG2b
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>m2a(silent)-srt-his
Plasmid#124807PurposeHDR template to knock-in FC silent mIgG2a isotype in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to FC silent producing cell lines.DepositorInsertMurine IgG2a (Fc silent)
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianMutationL234A/L235A/N297AAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG1-srt-his
Plasmid#124802PurposeHDR template to knock-in mouse IgG1 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG1 producing cell lines.DepositorInsertMurine IgG1
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianPromoter-Available SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-enRVR(E174R/S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1931)
Plasmid#114075PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-enRVR(E174R/S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-enRVR (E174R/S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R, S542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-enRR(E174R/S542R/K607R)-NLS(nucleoplasmin)-6xHis (AAS1902)
Plasmid#114077PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-enRR(E174R/S542R/K607R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-enRR (E174R/S542R/K607R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R/S542R/K607RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rAPOBEC1-gs-XTEN-gs-hdenAsCas12a(E174R/S542R/K548R/D908A)-gs-UGI-NLS(SV40)(enAsBE1.3) (RTW1296)
Plasmid#114083PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.3DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.3)
TagsSV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>mG3-srt-his
Plasmid#124805PurposeHDR template to knock-in mouse IgG3 Fc domain in rat IgG2a heavy chain locus. Use in combination with PX458-gR2A_ISO to convert rat IgG2a hybridoma to mouse IgG3 producing cell lines.DepositorInsertMurine IgG3
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterial and MammalianAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgPOLR2D
Plasmid#125769Purposeconstitutive expression of a guide RNA targeting human POLR2D (CRISPR positive control)DepositorInsertsgPOLR2D (POLR2D Human)
UseCRISPRAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHybr_r2a>Fab-srt-his
Plasmid#124810PurposeHDR template to knock-in sortag and histag in rat IgG2a heavy chain locus. Use in combination with PX459-gR2A_Hinge to convert rat IgG2a hybridoma to Fab' fragment producing cell lines.DepositorInsertrat IgG2a Hinge-G4S-Sortag-Histag
UseCRISPR; Hdr templateTagsHistag (HHHHHH) and Sortag (LPETGG)ExpressionBacterialPromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1897)
Plasmid#114074PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-RVR (S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationS542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262-ABE8e
Plasmid#161523PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE8e mediated A-G base editingDepositorInsertABE8e-zSpCas9(D10A)
UseCRISPR; Gateway compatible abe8e-zspcas9(d10a) en…ExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262m
Plasmid#161522PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE7.10 mediated A-G base editingDepositorInsertTadA(wt)-TadA(7.10)-zSpCas9(D10A)
UseCRISPR; Gateway compatible tada(wt)-tada(7.10)-zs…ExpressionPlantAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-tRNApromo-sgRNA-espCas91_1
Plasmid#167210PurposePlasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN440
Plasmid#137874PurposePiggyBac vector for expression of 3xgRNA targeting TCF4 for CRISPRa; mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN458
Plasmid#137876PurposePiggyBac vector for expression of 1x gRNA targeting TCF4 for CRISPRa;mRFP-T2A-BlasticidinRDepositorAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only