We narrowed to 15,447 results for: grn
-
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable sinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U6
Plasmid#173157PurposeSingle guide RNA cassette under U6 promoterDepositorInsertsgRNA cassette under U6 promoter
ExpressionPlantPromoterAtU6-26Available sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB8792
Plasmid#126910PurposeTemplate for PCR amplification of ADE2 gRNA biobrick for targeting Saccharomyces cerevisiae ADE2 geneDepositorInsertADE2 gRNA
UseSynthetic BiologyAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
SGL40C.EFS.RFP657
Plasmid#69147PurposeAdvanced lentiviral Vector for sgRNA (hU6 Promoter) delivery with RFP657 expression (EFS Promoter)DepositorInsertssgRNA
EFS
tagRFP657
Available sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GOLPH3 shRNA
Plasmid#163860PurposeshRNA targeting the coding sequences of GOLPH3DepositorInsertgolgi phosphoprotein 3 (GOLPH3 Human)
ExpressionMammalianAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-TRIM5
Plasmid#132938PurposeAll-in-one huTRIM5 rescue-TRIM5 shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable sinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_1
Plasmid#102970PurposeSuppression of FXNDepositorInsertshFXN_1 (FXN Human)
UseLentiviral and RNAiAvailable sinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_2
Plasmid#102969PurposeSuppression of ABCB7DepositorInsertshABCB7_2 (ABCB7 Human)
UseLentiviral and RNAiAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_1
Plasmid#102968PurposeSuppression of ABCB7DepositorInsertshABCB7_1 (ABCB7 Human)
UseLentiviral and RNAiAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable sinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#2
Plasmid#174145PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEE390
Plasmid#149280PurposeT-DNA encoding TRV2 with gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA:tNos
ExpressionPlantPromoter35SAvailable sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-RNF103-CHMP3
Plasmid#140584PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA RNF103-CHMP3
UseCRISPRAvailable sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.2#2/Cre
Plasmid#173661PurposeExpresses a NT.2-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
TC1078-30
Plasmid#164878Purpose30bp(mismatch17) cas13d gRNA for 1405 editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA for TC1405
ExpressionMammalianAvailable sinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only