We narrowed to 27,831 results for: cat
-
Plasmid#49217PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tagDepositorInsertClbB-NRPS
Tags6x His tag and T7 tagExpressionBacterialMutationcontains aa4-1080 of reference sequence NP_754362…PromoterT7Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIOM17
Plasmid#20870DepositorInsertaphA::cat
ExpressionBacterialAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL5
Plasmid#72989PurposeRBS_M2DepositorInsertM2 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL11
Plasmid#72995PurposeRBS_L4DepositorInsertL4 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL4
Plasmid#72988PurposeRBS_H5DepositorInsertH5 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL8
Plasmid#72992PurposeRBS_L1DepositorInsertL1 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-L1U1H09
Plasmid#73008PurposeL1U1H09 terminatorDepositorInsertL1U1H09 terminator
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pR6Ko2_FRTcamFRT
Plasmid#243904PurposeGoldenBraid2.0 Flp recombinase excisable antibiotic resistance cassette in the grammar of an assembled transcription unit. Ready to be amplified to make gene knockouts.DepositorInsertcat
ExpressionBacterialAvailable SinceFeb. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBSKa1_FRTcamFRT
Plasmid#243836PurposeGoldenBraid2.0 Flp recombinase excisable antibiotic resistance cassette in the grammar of an assembled transcription unit. May be omega-assembled with another transcription unit.DepositorInsertcat
ExpressionBacterialAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBSKa2_FRTcamFRT
Plasmid#243841PurposeGoldenBraid2.0 Flp recombinase excisable antibiotic resistance cassette in the grammar of an assembled transcription unit. May be omega-assembled with another transcription unit.DepositorInsertcat
ExpressionBacterialAvailable SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL6
Plasmid#72990PurposeRBS_M3DepositorInsertM3 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL7
Plasmid#72991PurposeRBS_M5DepositorInsertM5 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only