We narrowed to 952 results for: trna
-
Plasmid#193250PurposeExpresses the M. jannaschii tyrosyl-tRNA synthetase (MjTyrRS)DepositorInsertMjTyrRS
ExpressionBacterialPromoterhsp60Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUltra-sY
Plasmid#82417PurposeExpresses Mj aaRS for sulfotyrosine and Mj tRNA for decoding UAG codonsDepositorInsertMethanococcus jannaschii aaRS for sulfotyrosine
ExpressionBacterialMutationTyr32Leu, Leu65Pro, Asp158Gly, Ile159Cys, Leu162L…PromotertacIAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRARE-MBP-DEST
Plasmid#84650PurposeGateway cloning vector expresses MBP-tagged proteins under the control of the IPTG– inducible ptac promoter and also expresses several tRNAs that are rare in E. coli.DepositorTypeEmpty backboneTagsMBPExpressionBacterialPromotertacAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcBAc1-Ma-tfmW-RSA2
Plasmid#251519PurposeOrthogonal Methanomethylophilus alvus aaRS/tRNA-mediated incorporation of tfm-Tryptophan into sfGFP150TAG in HEK293T cellsDepositorInsertMa-tfmW-RSA2
ExpressionMammalianPromoterCMVAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTrpRS(H14)
Plasmid#231131PurposeExpresses mutant E. coli TrpRS from a derepressed lac promoter for proteome-wide incorporation of tryptophan analogues in E. coli/K. pneumoniae.DepositorInsertE. coli tryptophanyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTyrRS(VSMA,D165G)
Plasmid#231132PurposeExpresses mutant E. coli TyrRS from a derepressed lac promoter for proteome-wide incorporation of tyrosine in E. coli/K. pneumoniae.DepositorInsertE. coli tyrosyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationY37V, D165G, D182S, P183M, L186A, D265RAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSIP103: pTarget(CyCAST)
Plasmid#200849PurposeTarget plasmid containing CyPSP1 and attachement site for CyCAST.DepositorInsertsPAM for CyCAST + CyPSP1
tRNA-Leu
ExpressionBacterialAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xKBstTyrT(CUA)_EF1_sfGFP 102TAG 150TAA
Plasmid#174895Purposeamber and ochre dual suppression reporter sfGFP 102TAG 150 TAA expression, with BstTyr(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation102TAG 150TAA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
NSUN6
Plasmid#188060PurposeBacterial expression plasmid for human NSUN6; for activity testingDepositorAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSecUAG-Evol2
Plasmid#163148PurposeExpresses machinery necessary for selenocysteine incorporation at UAG codonsDepositorInsertsallo-tRNA UTu2D
thioredoxin
Selenophosphate synthase
Selenocysteine synthase
Cysteine desulfurase
ExpressionBacterialMutationCysteine 32 switched to Selenocysteine (UAG), Cys…PromoterEM7, araBAD, native As SelD promoter, and native …Available SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTH728-CEN-RLuc/maxCFLuc
Plasmid#38212DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAcBac3-EcLeu TAG-EGFP**
Plasmid#228785PurposeEcLeu aaRS/tRNA system for TAG suppression with EGFP containing two stop codons for dual suppressionDepositorInsertsEcLeuRS
EcLtR
EGFP**
UseBaculoviralExpressionMammalianMutationTAG suppressorAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTH726-CEN-RLuc/minCFLuc
Plasmid#38210DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-EcTrp-TGA
Plasmid#228780PurposeaaRS/tRNA system for incorporation of 5HTP within proteins in mammalian cells at TGA codonDepositorInsertsEcTrpRS
EcWtR
UseBaculoviralExpressionMammalianMutationTGA suppressorAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-EcTyr-TAG
Plasmid#228782PurposeEcTyr aaRS/tRNA system for mammalian ncAA incorporationDepositorInsertsEcTyrRS
EcYtR
BstR
UseBaculoviralExpressionMammalianMutationTAG suppressorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK-EcTrpRS(H14)-EcTyrRS(VSMA,D165G)
Plasmid#231130PurposeExpresses mutant E. coli TrpRSTyrRS from a glnS promoters for proteome-wide incorporation of tryptophan/tyrosine analogues.DepositorInsertE. coli tyrosyl tRNA synthetase
ExpressionBacterialMutationEcTrpRS: S8A, V144G, V146C; EcTyrRS: Y37V, D165G,…Available SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEL031
Plasmid#137900PurposeSTU2.0 SpyCas9 tRNA system for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only