We narrowed to 47,363 results for: cha;
-
Plasmid#59396PurposeMethyloBrick cloning vector, no promoter; KmRDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialPromoternoneAvailable SinceDec. 30, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)IRES GFP
Plasmid#51406PurposeExpresses GFP from internal ribosome entry sequence, cloning componentDepositorInsertIRES GFP
ExpressionMammalianPromoterCMVAvailable SinceMay 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-CaMKIIA
Plasmid#186825PurposeExpresses FLAG-CaMKIIA in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2-BSD-mApple
Plasmid#182308PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression, bsd selection, mAppleInsertsTagsT2A-mycNLS-mAppleExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGSKU
Plasmid#72243PurposeContains the CORE cassette with convergent KlURA3 and KanMX4 markers and the I-SceI gene under the inducible GAL1 promoterDepositorInsertsKlURA3
kanMX4
I-SceI
ExpressionBacterialAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGSHU
Plasmid#72244PurposeContains the CORE cassette with convergent KlURA3 and hyg markers and the I-SceI gene under the inducible GAL1 promoterDepositorInsertsKlURA3
hyg
I-SceI
ExpressionBacterialAvailable SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJN63 [pmyo-3::BeCyclOp::SL2::mCherry]
Plasmid#168173PurposeExpression of BeCyclOp in BWMs of C. elegansDepositorInsertBeCyclOp (codon optimized for C. elegans)
ExpressionWormAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-puro_UCOE_TRE3VG_mCherry-Responder
Plasmid#230053PurposeIt presents the UCOE sequence and the TRE3VG inducible promoter allowing a more stable dox-dependent inducible activation of mCherry though the OPTi-OX platform across differentiation of hiPSCsDepositorInsertUCOE
ExpressionMammalianPromoterTRE3VGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCVL Traffic Light Reporter 1.1 (Sce target) Ef1a Puro
Plasmid#31482DepositorInsertTraffic Light Reporter 1.1 (Sce Target) EF Puro
UseLentiviralMutationmCherry has M9S and M16L mutations. This is what …Available SinceAug. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
HRE-luciferase
Plasmid#26731PurposeLuciferase reporter construct containing three hypoxia response elements (24-mers) from the Pgk-1 gene.DepositorInsertHypoxia Responsive Elements (3)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceNov. 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
NLRP3-mNeonGreen
Plasmid#200942PurposeNLRP3 fused with mNeonGreen to indicate its localization changeDepositorInsertNLRP3 (NLRP3 Human)
UseLentiviralAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC
Plasmid#64874Purposelentiviral vector with Flag, HA tagsDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsFlag and HAExpressionMammalianAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) mFis1 V1
Plasmid#44600DepositorInsertmFis1 variant 1 (Fis1 Mouse)
ExpressionMammalianAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
Mfn2-Myc
Plasmid#23213DepositorAvailable SinceAug. 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-FLAG-BMAL1
Plasmid#186829PurposeExpresses FLAG-BMAL1 in mammalian cellsDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
p131CB10-tphKAB
Plasmid#241911PurposeTPA catabolic operon under the control of a PCA inducible biosensorDepositorInserttphK, tphA2, tphA3, tphB, tphA1
UseSynthetic BiologyMutationnoneAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only