We narrowed to 9,463 results for: Pol;
-
Plasmid#218004Purpose8xHis-tag fused to PreScission Protease cleavage site for protein purification and cleavageDepositorInsert8xHis-tag
UseSynthetic BiologyTagsPreScission protease cleavage siteAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Sensor_P2A_SLC2A4
Plasmid#221429PurposeGateway entry clone encoding a polyprotein that is cleaved to FRET glucose sensor and SLC2A4 proteinsDepositorInsertSensor_P2A_SLC2A4 (SLC2A4 Synthetic)
ExpressionMammalianAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-HAPPID1
Plasmid#204626PurposeExpresses the human anti-Phl p 7 IgD/λ antibody 102.1F10 (HAPPID1) in mammalian cells. HAPPID1 binds to the grass pollen allergen Phl p 7 with subnanomolar affinity.DepositorInsertsHAPPID1 heavy chain
HAPPID1 light chain
ExpressionMammalianPromotermouse elongation factor 1 alpha and rat elongatio…Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HPeV_3C
Plasmid#203465PurposeExpresses HPeV 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cox3-FusXTBE-Left TALE
Plasmid#196504PurposeExpresses left-side TALE–DddAtox N term half cox3-FusXTBE in zebrafishDepositorInsertIDH2 MTS-cox3 left TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cox1-FusXTBE-Left TALE
Plasmid#196502PurposeExpresses left-side TALE–DddAtox N term half cox1-FusXTBE in zebrafishDepositorInsertIDH2 MTS-cox1 left TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cox1-FusXTBE-RightTALE
Plasmid#196503PurposeExpresses right-side TALE–DddAtox C term half cox1-FusXTBE in zebrafishDepositorInsertIDH2 MTS-cox1 right TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cox3-FusXTBE-RightTALE
Plasmid#196505PurposeExpresses right-side TALE–DddAtox C term half cox3-FusXTBE in zebrafishDepositorInsertIDH2 MTS-cox3 right TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
tl1-FusXTBE-Left TALE
Plasmid#196506PurposeExpresses left-side TALE–DddAtox N term half tl1-FusXTBE in zebrafishDepositorInsertIDH2 MTS-tl1 left TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
tl1-FusXTBE-RightTALE
Plasmid#196507PurposeExpresses left-side TALE–DddAtox N term half tl1-FusXTBE in zebrafishDepositorInsertIDH2 MTS-tl1 right TALE-G1397 DddA-C-UGI-SV40 polyA
ExpressionBacterialAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUGP1.1
Plasmid#196615PurposePlasmid used for the C-terminal tagging of Ugp1 with mCherry and the auxin-inducible degron in yeastDepositorInsertUGP1::mCherry-AID(71-114)-NatMX (UGP1 Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_A37C-A44C
Plasmid#162582PurposeExpresses norovirus GI.1 VP1 protein with mutations A37C-A44C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAlanine 37 changed to Cysteine and Alanine 44 cha…PromoterpolyhedringAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_Q141V-P221L
Plasmid#162584PurposeExpresses norovirus GI.1 VP1 protein with mutations Q141V-P221L in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlutamine 141 changed to Valine and Proline 221 c…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_L144C-P221C
Plasmid#162585PurposeExpresses norovirus GI.1 VP1 protein with mutations L144C-P221C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationLeucine 144 changed to Cysteine and Proline 221 c…PromoterpolyhderinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_G131C-N172C
Plasmid#162586PurposeExpresses norovirus GI.1 VP1 protein with mutations G131C-N172C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationGlycine 131 changed to Cysteine and Asparagine 17…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1_GI.1_N167C-L169C
Plasmid#162587PurposeExpresses norovirus GI.1 VP1 protein with mutations N167C-L169C in Sf9 insect cellsDepositorInsertVP1 protein from human norovirus GI.1
ExpressionInsectMutationAsparagine 167 changed to Cysteine and Leucine 16…PromoterpolyhedrinAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-ADAP1
Plasmid#163906PurposeFull length mouse ADAP1 with N terminal fluorescent tag for purification from insect cellsDepositorAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-CD52-bglpA
Plasmid#89704PurposeHuman CD52 expression plasmid with short polyADepositorAvailable SinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
Plasmid#79030PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
TagsOneSTrEP-FLAGExpressionInsectMutationdeleted amino acid 294-515 from frican green monk…PromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only