We narrowed to 16,083 results for: nes
-
Plasmid#48083PurposeMammalian expression of Gal4 tagged MeCP2-R270XDepositorInsertMethyl-CpG Binding Protein 2 (Rett Syndrome) (MECP2 Human)
TagsGal4ExpressionMammalianMutationexpresses AT-Hook R270XAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
GRM1
Plasmid#25353PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertGRM1-C254S:L28-G518 (GRM1 Human)
TagsHisExpressionInsectMutationC254S. Contains amino acids L28-G518.Available SinceJuly 29, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.2/V5 mmu-mir-139
Plasmid#26329DepositorInsertmmu-mir-139 (Mir139 Mouse)
ExpressionMammalianAvailable SinceSept. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
ARF17 pGreenII0229
Plasmid#12070DepositorAvailable SinceJune 2, 2006AvailabilityAcademic Institutions and Nonprofits only -
p_sc-eVIP-delta-Puro-EGFP-SMAD4-R361H
Plasmid#249484PurposeTransfer plasmid for stable transgene expression with 2nd or 3rd generation lentiviral systemsDepositorAvailable SinceJune 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pV1210
Plasmid#242891PurposeModified plasmid from pV1200 to perform ENO1-SI CRISPR in Candidozyma aurisDepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-ABE8e-nSpCas9
Plasmid#237460PurposeTransfection-based all-in-one base editor plasmid that expresses both adenine base editor (ABE8e-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_ABE8e_SpCas9(D10A)_6xNLS
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX461-evoCDA1-nSpCas9
Plasmid#237461PurposeTransfection-based all-in-one base editor plasmid that expresses both cytosine base editor (evoCDA1-nSpCas9) and single guide RNAs (sgRNA) with BpiI cloning sites to clone sgRNA.DepositorInsert3xFlag_evoCDA1_ssDBD_nickase SpCas9 _6xUGI
UseCRISPRTags3xFLAGExpressionMammalianMutationD10APromoterchicken beta-actin promoter & U6Available SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
3xFLAG-dCas9/pMSCVneo
Plasmid#134982PurposeExpresses 3xFLAG-dCas9 in mammalian cells for enChIP analysis to purify specific genomic regions of interest.DepositorInsert3xFLAG-dCas9
UseCRISPR and RetroviralTags3xFLAG tag and NLSExpressionMammalianMutationhuman codon-optimized, D10A + H840APromoterLTRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
PET-SpCas9-HF1-plus-NLS-6xHis
Plasmid#207381PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInsertSpCas9-HF1-plus
UseCRISPRTags6xHisExpressionBacterialMutationN497A, Q695A, Q926A, amino acids 1005-1013 replac…PromoterT7Available SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-Sniper SpCas9 (without sgRNA; with silent mutations)
Plasmid#126777PurposeExpression plasmid for human codon-optimized increased fidelity Sniper SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertSniper SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationF539S, M763I, K890NPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
B-HeFSpCas9
Plasmid#126766PurposeExpression plasmid for human codon-opt. increased fidelity Blackjack-HeFSpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than HeFSpCas9.DepositorInsertB-HeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A; R661A; Q695A; K848A; Q926A; K1003A; R1060A…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SERK1 A6_pECIA14
Plasmid#114767PurposePrey vector SERK1 A6_pECIA14 should be used with bait vector SERK1 A6_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9-E566-LOV-C450A-D432V(M519)
Plasmid#250779PurposePotent temperature-deactivated SpyCas9DepositorInsertSpyCas9 with an AsLOV2 insertion behind E566 and C450A and D432V mutation
UseCRISPRTags3xFLAGExpressionMammalianMutationC450A, D432VAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSA097 HNRNPK_IVS3-Cas9-BFP
Plasmid#249147PurposeOverexpression of SpCas9-BFP with HNRNPK IVS3 intron in 5' UTR and blasticidin resistance gene. Contains Cp36 recombination site.DepositorInsertHNRNPK_IVS3-Cas9-TagBFP (HNRNPK Human, S. pyogenes Cas9, synthetic)
UseCRISPR; Cp36 donor dnaExpressionMammalianMutationHNRNPK IVS3 intronPromoterEF1aAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9-KRAB_sgRNA Td2
Plasmid#176264PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged to the KRAB domain and Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJT121_GalL_nCDA1-VQRBE3
Plasmid#145086PurposeExpressing base editor nCDA1-VQRBE3 in yeast cellsDepositorInsertnCDA1-VQRBE3
UseCRISPRExpressionYeastMutationspCas9(D10A, D1135V, R1335Q, T1337R)PromoterGalLAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
RCAS-Neu HA SIINFEKL
Plasmid#125832PurposeRetroviral expression of rat Neu cDNADepositorInsertNeu (Erbb2 Rat)
UseRetroviralTags2x HA and SIINFEKLExpressionMammalianMutationVal to Glu point mutation of codon 664 and trunca…Available SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
SERK1 A6_pECIA2
Plasmid#114967PurposeBait vector SERK1 A6_pECIA2 should be used with prey vector SERK1 A6_pECIA14.DepositorInsertAT1G71830 (SERK1 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only