We narrowed to 19,295 results for: cat
-
Plasmid#145683PurposeBacterial Expression plasmid for SARS-CoV-2 RNA-dependent RNA polymeraseDepositorInsertSARS-CoV-2 RNA-dependent RNA polymerase (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;HAExpressionBacterialMutationwtPromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046945
Plasmid#145668PurposeBacterial Expression plasmid for SARS-CoV-2 E (envelope)DepositorInsertSARS-CoV-2 E (envelope) (E Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;StrepIIExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046876
Plasmid#145669PurposeBacterial Expression plasmid for SARS-CoV-2 nsp3DepositorInsertSARS-CoV-2 nsp3 (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;MycExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046766
Plasmid#145612PurposeBacterial Expression plasmid for SARS-CoV-2 helicaseDepositorInsertSARS-CoV-2 helicase (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;StrepIIExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046949
Plasmid#145604PurposeBacterial Expression plasmid for SARS-CoV-2 E (envelope)DepositorInsertSARS-CoV-2 E (envelope) (E Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;FLAG_2ExpressionBacterialMutationwtPromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046763
Plasmid#145606PurposeBacterial Expression plasmid for SARS-CoV-2 M (membrane)DepositorInsertSARS-CoV-2 M (membrane) (M Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;FLAG_2ExpressionBacterialMutationwtPromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046804
Plasmid#145595PurposeBacterial Expression plasmid for SARS-CoV-2 nsp8DepositorInsertSARS-CoV-2 nsp8 (ORF1ab Escherichia coli str. K-12 substr. MG1655; Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;StrepIIExpressionBacterialMutationEscherichia coli recode 1PromoterPromoter | pT7 ; Operator | lacO ; RBS | T7_rbs ;…Available SinceApril 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
RPS6KB2 gRNA (BRDN0001146372)
Plasmid#76057Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-101-526aa-YFP
Plasmid#29603DepositorAvailable SinceJuly 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-267-526aa-YFP
Plasmid#29605DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
nCre-ST-NLS-P2A-NLS-pSC-cCre
Plasmid#207638PurposeA plasmid encoding N-terminal Cre fused to SpyTag (ST) and photocaged SpyCatcher (pSC) fused to C-terminal Cre with a nuclear localization signal (NLS) sequenceDepositorInsertnCre-SpyTag-NLS-P2A-NLS-photocaged SpyCatcher-cCre
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S::Cel1SP-GeNL/pCAMBIA1301
Plasmid#190069PurposeExpressing bioluminescent pH indicator-GeNL- in Arabidopsis thaliana apoplastDepositorInsertCel1 signal peptide-Green-enhanced Nano-lantern
ExpressionPlantPromoterCaMV 35SAvailable SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (787-1899)
Plasmid#170145PurposeExpresses residues 787-1899 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationN-terminal truncation of residues 1-786; C-termin…Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (787-2138)
Plasmid#170146PurposeExpresses residues 787-2138 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationN-terminal truncation of residues 1-786; C-termin…Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMP108 Nanog-Venus-2a-mCherry
Plasmid#159743PurposeNanog targeting vector to insert fluorescent reporter of protein and gene expression levels from endogenous locus in mouse embryonic stem cells. Please see depositor comments for more detail.DepositorAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MAP3K12 gRNA (BRDN0001144753)
Plasmid#76760Purpose3rd generation lentiviral gRNA plasmid targeting human MAP3K12DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL2-HKII-E
Plasmid#64517PurposeAS-30D hepatoma hexokinase II 0.1 kbp promoter-luciferase reporter vectorDepositorInsertType II hexokinase gene, partial cds and promoter region (Hk2 Rat)
UseLuciferaseTagsfirefly luciferaseMutationIsolated from AS-30D rat hepatomaPromoterHexokinase IIAvailable SinceJune 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgAMPKa1-Cas9-GFP
Plasmid#208049PurposeLentiviral vector expressing Cas9 and an sgRNA targeting AMPKa1DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPU-huMDA5-miR30-MDA5
Plasmid#174224PurposeAll-in-one huMDA5 rescue-MDA5 shRNA knockdown vectorDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only