We narrowed to 47,976 results for: Ina
-
Plasmid#166542PurposescFv of a human scaffold targeting Leucyl-tRNA synthetase. Antigen coverage aa 260-509 of 1176DepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
J-HARS-4
Plasmid#166529PurposescFv of a human scaffold targeting Histidyl-tRNA synthetase. Antigen coverage aa 1-509 of 509, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
L-SARS-7
Plasmid#166527PurposescFv of a human scaffold targeting Seryl-tRNA synthetase. Antigen coverage aa 1-514 of 514, full-lengthDepositorInsertsingle chain-Fv, scFv
UseRecombinant antibody expressionTags3xFLAG, His6 and OmpA leader sequenceExpressionBacterialPromoterLacZAvailable SinceApril 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBacDual with LFn + FlaAAA
Plasmid#84867PurposeBaculovirus Expression of LFn-FlaAAA fusion. This is a negative control for LFn FlaA in which the 3 C-terminal leucines have been replaced by alanine.DepositorInsertsLFn
FlaAAA
UseBaculovirusTags6xHisExpressionInsectMutation3 C-terminal leucines have been replaced by alani…PromoterPolyhedrinAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT/Caggs-NRAS G12V-IRES-ASK1
Plasmid#221074PurposeExpresses NRAS G12V and ASK1 in mammalian cellsDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
HcRed-pcw107-V5
Plasmid#64647Purpose(control) when used to produce lentivirus, express physiological levels of insertDepositorInsertn/a
UseLentiviralTagsV5PromoterPGKAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-Fc-His
Plasmid#72168PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pR008_APAD
Plasmid#204818PurposeExpression Apobec1-ADAR2dd fusion protein as PIE-RBP controlDepositorInsertrat Apobec1 and human ADAR2 deaminase domain with engineered sites (Apobec1 Rat)
TagsHA and Flag and huADAR2ddExpressionMammalianPromoterchicken β-actin promoterAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
LAP2-beta-actin in modified pEGFP
Plasmid#34839DepositorAvailable SinceFeb. 1, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDG-K341R
Plasmid#52267PurposeBacterial expression of mouse TDG-K341R with C-terminal GST-tagDepositorInsertTDG (Tdg Mouse)
TagsGSTExpressionBacterialMutationK341R, SUMO acceptor site mutationPromoterT7Available SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema3f(L,+)-AP-His
Plasmid#72021PurposeExpresses the Sema3F protein (truncated at cleavage site P3; ie, long and contains no deletion in exon 3), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
RhopH3-bio
Plasmid#47781PurposeExpresses enzymatically monobiotinylated full-length RhopH3 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH3
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 LIC 6A CARD8-FLAG S297A
Plasmid#169949PurposeMammalian expression of CARD8-FLAG that is autoprocessing-deficient (S297A)DepositorAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
SI16-Kit a
Plasmid#58948Purposeexpresses recombinant mouse anti-Kit a receptor (zebrafish) IgG1 antibody in mammalian cellsDepositorAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema6d.1-AP-His
Plasmid#72042PurposeExpresses the extracellular region of the Sema6D, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOCC120
Plasmid#118892Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal MBP tag, cleavable with 3C, and C-terminal monomeric GFP and HIS6, cleavable with TEVDepositorInsertNcoI-MBP-3C-NotI-ccdB-AscI-mGFP-3C-HIS6-stop-HindIII cassette
TagsMBP, cleavable with 3C protease and mGFP, HIS6, c…ExpressionInsectPromoterpolHAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFPm-DAD M1041A
Plasmid#25411DepositorInsertDiap3 (Diaph3 Mouse)
TagsEGFP, His, and MycExpressionMammalianMutationAlanine substitution at critical residue in DAD t…Available SinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGEX nsp1 R99A CoV2
Plasmid#175515PurposeFor protein expression of R99A nsp1 CoV2DepositorInsertR99A nsp1 CoV2
TagsGST tagExpressionBacterialPromotertac promoterAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only