We narrowed to 41,273 results for: LAT;
-
Plasmid#122865PurposeBinary expression vector containing 35S:MS2-KYP:tRBCS followed by GreenGate A-G sequences for insertion of additional modulesDepositorInsert35S:MS2-KYP:tRBCS
UseGolden gate compatible plant transformation vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJL032
Plasmid#122855PurposeKYP SET domain with GreenGate D-E flanking sequencesDepositorInsertSET catalytic domain of KYP H3K9 histone methyltransferase
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJL035
Plasmid#122854PurposeG9a SET domain with GreenGate D-E flanking sequencesDepositorInsertG9a SET catalytic domain, codon-optimised for Arabidopsis
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJL023
Plasmid#122841Purposep300 core domain with GreenGate D-E flanking sequencesDepositorInsertCore domain of p300 H3K27 histone acetyltransferase, codon-optimised for Arabidopsis
UseGolden gate compatible cloning vectorAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMH186
Plasmid#122837PurposeMS2-NLS (no stop codon) with GreenGate C-D flanking sequencesDepositorInsertMS2-NLS, codon-optimised for Arabidopsis
UseGolden gate compatible cloning vectorTagsNuclear localisation signalAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L1-CAMKII(0.4)-R5
Plasmid#32578DepositorInsertCAMKIIalpha promoter 0.4kb version
UseGateway cloning vectorAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pProm9_BCD1-GFP
Plasmid#80655PurposePromoter9 with BCD1-gfpDepositorInsertGFP
UseP15a origin, constitutive promoter, kanrMutationNONEPromoterconstitutive promoterAvailable SinceAug. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pCR-Blunt_hM3O
Plasmid#112638PurposePlasmid for PCR amplification of hM3O DNA template for in vitro transcriptionDepositorInserthM3O
UsePcr templatePromoterT7Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
RV 2-5
Plasmid#68410PurposeRetroviral backbone for use with GMAPDepositorTypeEmpty backboneUseRetroviral; GmapExpressionMammalianPromoterLTRAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4r-LucmiR-EGFP-R3r
Plasmid#32589DepositorInsertIntronic Luciferase miRNA and EGFP
UseGateway cloning vectorAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS426-ACT_unstable
Plasmid#127608Purposehigh-copy URA-selectable plasmid, WT ACT1 intron (unstable) inserted into URA3DepositorInsertUnstable ACT1 intron (WT)
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS426-ECM_stable
Plasmid#127606Purposehigh-copy URA-selectable plasmid, WT ECM33 intron (stable) inserted into URA3DepositorInsertStable ECM33 intron (WT)
ExpressionYeastAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
PRRX2-pBLSK
Plasmid#21012DepositorInsertPRRX2 (Prrx2 Mouse)
ExpressionBacterialMutationMissing first three amino acids at N-terminusAvailable SinceAug. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
-
pGLx2-SET1
Plasmid#53256PurposeGAL driven LexA-tagged SET1DepositorInsertSET1
TagsLexAExpressionYeastPromoterGAL1/10Available SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAP998-5
Plasmid#99501Purpose3XFlag::tagBFP::linker::TEVDepositorInsert3XFlag::tagBFP::linker::TEV
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP683-2
Plasmid#99488PurposeTEV::eGFP::ER::HA::linker::3XFlagDepositorInsertTEV::eGFP::RE::HA::linker::3XFlag
ExpressionBacterialAvailable SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only