We narrowed to 15,169 results for: GRN
-
Plasmid#120720PurposeLentiviral vector that expresses GFP and an shRNA targeting Esr1 (in pLL3.7).DepositorInsertEsr1 shRNA (Esr1 Mouse)
UseLentiviral and RNAiTagsGFPExpressionMammalianPromoterMouse U6Available SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUDE722
Plasmid#103022Purposeexpression of a Cpf1 programming crRNA targetting CAN1 (crCAN1-4S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-sh4EBP2
Plasmid#81121Purposeexpresses an shRNA targeting murine 4E-BP2DepositorInsert4E-BP2 shRNA (Eif4ebp2 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available SinceSept. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA1
Plasmid#59303PurposeKnockdown of human FOXH1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Neo-TGmiR-Gb2
Plasmid#25746PurposeControl lentiviral vector with Tet-based inducible expression of mouse G beta 2 miR30-based shRNA and GFP, constitutive Neomycin resistance gene coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-EFS-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188771PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterEFSAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLX311-SHOC2-V5
Plasmid#134521PurposeLentiviral plasmid expressing SHOC2 with V5 C-term tagDepositorInsertSHOC2 (SHOC2 Human)
UseLentiviralTagsV5ExpressionMammalianMutationSilent mutations made at wobble base position at …PromoterEF1alphaAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LEP-shMLL-AF9.1039
Plasmid#105566Purposeretrovirally express MLL-AF9 shRNA with puro resistance and GFP markerDepositorInsertshRNA targeting MLL part of MLL-AF9 fusion
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGAC
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2res
Plasmid#106301PurposeExpresses SHMT2DepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationSilent mutations destroy sgRNA targeting sitesAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ANLN
Plasmid#183834PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertANLN homology arms with mNeonGreen-linker (ANLN Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
B270 + SMARCAL1 sgSTOP
Plasmid#100717PurposeB270 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI) and ATP1A1 (SMARCAL1 Human)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSc1
Plasmid#80436PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceAug. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-SID4x-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188901PurposedCas9 with an N-term Sid4x fusion, a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertSID-dCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1) fusion, P2A-GF…PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaActin binding domain
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-ovoD1
Plasmid#111142PurposeExpresses U6:3-sgRNA targeting ovoD1 mutation in Drosophila melanogasterDepositorAvailable SinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only