We narrowed to 10,034 results for: Pol
-
Plasmid#177893PurposeBaculo expression of His10 tag fused to human LckG2ADepositorAvailabilityAcademic Institutions and Nonprofits only
-
pLIB-GST-TEV-RSP3(160-516)
Plasmid#176692PurposeExpression of Chlamydomonas reinhardtii RSP3 recombinant protein in insect cellsDepositorInsertRSP3
TagsGSTExpressionInsectMutationNonePromoterpolyhedrinAvailabilityAcademic Institutions and Nonprofits only -
EC1000
Bacterial Strain#71852PurposeRepA+ MC1000, KmR , carrying a single copy of the pWV01 repA gene in the glgB gene; host for pOR128-based plasmidsDepositorBacterial ResistanceKanamycinAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-CoRESTfl
Plasmid#109156PurposeEncodes human full-length CoREST with C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length CoREST, sequence-optimized for insect cells (RCOR1 Human)
Tags3xFLAGExpressionInsectPromoterPolyhedrinAvailable SinceJan. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_eGFP
Plasmid#135474PurposeEncodes Marburg virus minigenome with eGFP reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, eGFP reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_luciferase
Plasmid#135475PurposeEncodes Marburg virus minigenome with luciferase reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, luciferase reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
mRFP-LAP2β
Plasmid#228029Purposelentiviral construct for mRFP-LAP2β expressionDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
PhyB-mCherry-Spc72
Plasmid#51582PurposeConstitutively express spindle pole body localized PhyB in Saccharomyces cerevisiaeDepositorInsertPhyB (PHYB Mustard Weed)
TagsSpc72 and mCherryExpressionYeastMutation1-908aa onlyPromoterADH1prAvailable SinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-21222-SIN3B-3xFLAG
Plasmid#109214PurposeEncodes human full-length SIN3B with a C-terminal 3xFLAG tag to be expressed in a baculovirus/insect cell expression systemDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-TREG3G-PE2-rtTA3G-P2A-eGFP
Plasmid#196971PurposePiggybac vector with doxycyclin-inducible prime editor for mammalian cellsDepositorInsertsCas9-RT
rtTA3G-P2A-eGFP
ExpressionMammalianPromoterPGK and TREG3GAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAV5B+longBRD4
Plasmid#157792PurposeExpression of long isoform of BRD4DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCB’
Plasmid#162703PurposepCB reconstructed after selection for CCMB1 growth on glycerol under ambient airDepositorInsertpHnCB10 derived carboxysome operon, prk
ExpressionBacterialMutation5513T>G (tetR E37A); 7758G>T (second tet op…PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-eIF3b
Plasmid#240025PurposeHuman eIF3b for further cloning or expression in insect cells for purificationDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOCC175
Plasmid#118890Purposeshuttle vector for baculovirus production, using FlashBac bacmid; for recombinant protein with N-terminal HIS6-MBP tag, cleavable with 3C, and N-terminal monomeric GFP, cleavable with TEVDepositorInsertNcoI-HIS6-MBP-3C-mGFP-TEV-NotI-ccdB-AscI-stop-HindIII cassette
TagsHIS6-MBP, cleavable with 3C protease; mGFP, cleav…ExpressionInsectPromoterpolHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only