We narrowed to 27,636 results for: GFP
-
Plasmid#208779PurposeInducibly expresses human NINJ1 tagged with GFPDepositorAvailable SinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only
-
PEX3*-SBP-GFP
Plasmid#120174PurposeExpresses a chimera of the peroxisomal-targeting signal of PEX3, SBP tag and GFP (fluorescent tag)DepositorInsertPeroxisomal biogenesis factor 3 (PEX3 Human)
TagsSBP and eGFPExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRESh-GFPII-S-Dlk1
Plasmid#108931PurposeGFP-tagged vector expressing secreted isoform of Dlk1DepositorInsertDlk1 (Dlk1 Mouse)
TagsGFPIIExpressionMammalianMutationcontains sequences from full length Dlk1A up to t…Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-Ago2
Plasmid#74231PurposeGFP-Ago2 lentiviral vectorDepositorAvailable SinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV asRILpolyGly GFP (OPDM type 4)
Plasmid#250411PurposeGFP-tagged polyglycine protein expressed from the antisense transcript of RILPL1. This vectors uses 100 GGN optimized codons.DepositorInsertasRILpolyGly
UseAAVTagsGFPExpressionMammalianAvailable SinceMarch 16, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFPN1-ATG9A
Plasmid#198529PurposeExpression of ATG9A-GFP fusion protein in mammalian cellsDepositorInsertATG9A (ATG9A Human)
TagsEGFPExpressionMammalianMutationsilent mutations in codons 4 and 775PromoterCMVAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-YOD1
Plasmid#85664PurposeExpression of human YOD1 with N-terminal GFP tagDepositorAvailable SinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-nArgBP2
Plasmid#74514PurposeExpress GFP-nArgBP2 fusion protein in mammalian cellsDepositorAvailable SinceJuly 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pATF4-donor
Plasmid#113805PurposeCRISPR donor plasmid to tag human transcription factor ATF4 with GFPDepositorInsertATF4 homology arms flanking EGFP-IRES-Neo cassette (ATF4 Human)
UseCRISPRMutationrs140428747Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMTF1-donor
Plasmid#113829PurposeCRISPR donor plasmid to tag human transcription factor MTF1 with GFPDepositorInsertMTF1 homology arms flanking EGFP-IRES-Neo cassette (MTF1 Human)
UseCRISPRAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C-donor
Plasmid#113824PurposeCRISPR donor plasmid to tag human transcription factor TFAP2C with GFPDepositorInsertTFAP2C homology arms flanking EGFP-IRES-Neo cassette (TFAP2C Human)
UseCRISPRMutationrs6025024, hg38:20:56638660:TTT/-Available SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO/GFP-ZNF598
Plasmid#141191PurposeExpresses GFP-ZNF598 in mammalian cells, can be used to make inducible cell lineDepositorAvailable SinceJune 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-IRAlus-Apobec3G
Plasmid#92349PurposePlasmid for expression of GFP gene with a Apobec3G gene intron derived IR Alu element containing 3'UTR.DepositorInsertApobec3G gene intron derived IR Alu element containing 3'UTR (APOBEC3G Human)
ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-CYLD-C601A
Plasmid#60028PurposeN-terminal GFP tagged catalytic inactive (C601A) expressionDepositorInsertCylindromatosis (CYLD Human)
TagsGFPExpressionMammalianMutationCysteine 601 changed to AlaninePromoterCMVAvailable SinceNov. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-LiMETER-v2
Plasmid#113934PurposeAlso termed as OptoPBer; Express an STIM1-derived optical tether to label and interrogate ER-plasma membrane contact sites (MCS) with light; visualized by GFPDepositorInsertLOV2 and Stim1 polybasic domain (PB)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV_GFP_24
Plasmid#238190PurposeEmpty lentiviral vector for expressing protein sequences fused to GFP and FTH1 (24-mer), under a CMV promoterDepositorTypeEmpty backboneUseLentiviralTagsGFP-FTH1 and SV40ExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Klc1-GFP
Plasmid#186617PurposeEncodes Kinesin Light Chain 1 fused to GFPDepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENeGFP PCNAL2 pc653
Plasmid#167564PurposeThe GFP-PCNAL2 fusion protein contains a SV40 nuclear localization signal at the NH2 terminus followed by an enhanced mutant GFP gene that is fused to the human PCNA by a linker.DepositorAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-PI4K2A
Plasmid#221760PurposeStable expression of GFP-PI4K2A in mammalian cellsDepositorAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only