We narrowed to 14,263 results for: crispr grnas
-
Plasmid#173662PurposeExpresses a NT.3-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#1/Cre
Plasmid#173643PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRbm10#2/Cre
Plasmid#173651PurposeExpresses a Rbm10-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rbm10 (Rbm10 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgWrn#1/Cre
Plasmid#173625PurposeExpresses a Wrn-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Wrn (Wrn Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#2/Cre
Plasmid#173610PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgWrn#2/Cre
Plasmid#173626PurposeExpresses a Wrn-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Wrn (Wrn Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#2/Cre
Plasmid#173644PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPole#1/Cre
Plasmid#173609PurposeExpresses a Pole-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pole (Pole Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9PromoterU6 and CBhAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKCcas9dO
Plasmid#62552PurposeHigh efficiency Streptomyces genome editing by CRISPR/Cas9 systemDepositorInsertsScocas9
sgRNA ()
act-orf4 homology arm
UseCRISPR; Bacterial genome editingExpressionBacterialPromoterj23119 and ptipAAvailable SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPbHiT_3xmyc_hsp70UTR_hdhfr/yfcu
Plasmid#216421PurposeEmpty backbone to express gene specific gRNA and carry the homology repair template for CRISPR editing of Plasmodium berghei using the PbHiT system.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiTags3xmycExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu
Plasmid#216422PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330S-2-PITCh
Plasmid#63670PurposeExpresses Cas9 nuclease and the PITCh-gRNADepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianPromoterCBhAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
BPK2660
Plasmid#70709PurposeHuman expression plasmid for SaCas9 sgRNA(84nt in length) (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sa-sgRNA(84)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only