We narrowed to 17,425 results for: mal.2
-
Plasmid#10748DepositorAvailable SinceSept. 27, 2005AvailabilityAcademic Institutions and Nonprofits only
-
5HT6-YFP-ThymosinBeta4(KK18,19EE)
Plasmid#96807Purposenon-actin-binding control for 5HT6-YFP-ThymosinBeta4(WT)DepositorInsert5HT6-YFP-ThymosinBeta4 (Tmsb4x Mouse)
TagsYFPExpressionMammalianMutationKK18,19EE prevents G-actin bindingAvailable SinceSept. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
SynNotch TMD/Gal4-VP64 ICD (MTK 3b) (pAN1031)
Plasmid#194222PurposeMammalian Toolkit part 3b encoding SynNotch and GAL4-VP64 to be used in designing modular receptorsDepositorInsertSynNotch-GAL4 DBD-VP64 AD
UseSynthetic BiologyPromoterNoneAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRV FOXP3 WWRR
Plasmid#13625DepositorInsertFOXP3 (FOXP3 Human)
UseRetroviralTagsMycExpressionMammalianMutationWWRR: T359W, N361W, E399R, E401RAvailable SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRL K-ras 3'UTR mutant
Plasmid#14805DepositorInsertK-ras 3'UTR (Kras Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationlet-7 miRNA binding site mutationsAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONRG_P4-P1R:MUM4_0.3Pro_35S
Plasmid#128558PurposeGateway (Invitrogen) promoter clone (pDONRG_P4-P1R) containing a 307 bp MUM4 (At1g53500) promoter fragment fused to the 54 bp 35S minimal promoter sequence, for use in Three-way Gateway cloningDepositorTypeEmpty backboneUseGateway promoter entry clonePromoterMUM4 core promoter with 35S enhancerAvailable SinceSept. 25, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLNCX2-Orai1
Plasmid#89818PurposeExpress Orai1 in mammalian cellsDepositorInsertOrai1 (ORAI1 Human)
UseRetroviralAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMP71-mtGFP-llo-lama4-alg8
Plasmid#174605Purposeexpresses palmytoylated GFP with a C terminal fusion of the LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 and Lama4DepositorInsertpalmytoylGFP w/C-term fusion LLO190 and minigenes of 2 neoantigens from the T3 tumor in genes Alg8 Lama4
ExpressionMammalianAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-C-intein-C-spC9-H840A-N863A-2xNLS-hGH
Plasmid#112211PurposeTargeted DNA methylationDepositorInsertC-terminus of dCas9
UseAAVMutationD10AAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLacI-GFP-HEC1 WT
Plasmid#114049PurposeExpression of exogenous LacI-GFP-HEC1 WTDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-376a1(5p)-WT
Plasmid#215875PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-376a1(5p)-WT (MIR376A1 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-376a1(3p)-WT
Plasmid#215876PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-376a1(3p)-WT (MIR376A1 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-589(5p)-WT
Plasmid#215877PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-589(5p)-WT (MIR589 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-589(3p)-WT
Plasmid#215878PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-589(3p)-WT (MIR589 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-376a1(5p)-I-type
Plasmid#215882PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of 376a1(5p)-I-type (MIR376A1 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-22(3p)-I-type
Plasmid#215886PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-22(3p)-I-type (MIR22 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-99a-I-type
Plasmid#215888PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-99a-I-type (MIR99A Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FLAG-Co-RHD
Plasmid#180198PurposeExpresses FLAG-tagged version of the Co-NF-kB Rel Homology DomainDepositorInsertCo-RHD
TagsFLAG-tagged fusion proteinExpressionMammalianMutationaa 2-582PromoterCMVAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only