We narrowed to 10,076 results for: control
-
Plasmid#231183PurposeExpresses control plasmid for ER-mitochondrial linkers, tagged with EBFP2, in mammalian cellsDepositorInsertER-EBFP2
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F2-empty vector
Plasmid#125552PurposeN2H assay vector with nanoluc fragment2 (empty control, no Gateway cloning site, expressing nanoluc fragment2)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F1-empty vector
Plasmid#125551PurposeN2H assay vector with nanoluc fragment1 (empty control, no Gateway cloning site, expressing nanoluc fragment1)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
DRH002_scAAV-hSyn-delta_iCre-HA
Plasmid#225087PurposeExpression of inactive delta-iCre (control) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertdelta_iCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
Plasmid#199551PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1β-hHNF4α-hHNF6) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBFC0625
Plasmid#186691PurposeVcDART under control of Lac promoter, Vc_lacZ_α_1 gRNA, GmR+sfGFP cargoDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_lacZ_α_1 Spacer crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pBG-mCRE98-NLS-EGFP-WPRE
Plasmid#239977Purposeadeno-associated virus (AAV) encoding enhanced green fluorescent protein (eGFP) under motor neuron-selective control of minimal beta globin promoter (pBG) and CRE98DepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
TdLanYFP-AURKA-Aquamarine
Plasmid#228562PurposeEncodes the AURKA biosensor where LC3B is flanked by the Aquamarine/TdLanYFP donor/acceptor FRET pair and under the control of the CMV promoter.DepositorAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(5’UTR)-FF
Plasmid#85486PurposeFirefly luciferase under the control of ATP5O 5'UTRDepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DIO-GRAB_CRFmut
Plasmid#208663PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) control sensor GRAB_CRFmut in a cre-dependent mannerDepositorInsertGPCR activation based corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut
UseAAVPromoterEFSAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBFC0694
Plasmid#186693PurposeShDART under control of Lac promoter, original configuration (pre-gRNA terminator and J23119 promoter), Sh_lacZ_α_1 gRNA, GmR+sfGFP cargoDepositorInsertstnsB
tnsC
tniQ
Cas12k
Sh_lacZ_α_1 gRNA
Tn7 transposon
GmR+sfGFP ShDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS-TRE-FHDnd1-Ubc-rtTA-I2G
Plasmid#70076Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cellsDepositorInsertDnd1 (Dnd1 Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSilent mutations are introduced to escape from RN…PromoterTet responsible promoterAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
miniTol2 x EF1a_EKAREN5(TA) + PGK-puro
Plasmid#167819Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
Tagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLINC-AKAR1(TA)-CAAX
Plasmid#87706PurposeNegative-control mutant of FLINC-AKAR1-CAAX.DepositorInsertFLINC-AKAR1(TA)-CAAX
Tags6xHis, C-terminal targeting sequence from Kras, T…ExpressionMammalianMutationTarget Thr residue in substrate domain mutated to…PromoterCMVAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP_AAVS1
Plasmid#141211PurposepDECKO_GFP_AAVS1_1801. Targeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only