We narrowed to 8,061 results for: 110
-
Plasmid#110893PurposeExpression of Myc-tagged hTIM3 at the cell surfaceDepositorInsertHepatitis A virus Cellular Receptor 2 (HAVCR2) (HAVCR2 Human)
UseRetroviralTagsMycPromoterCMVAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBiFC-PBZ-4A-VN
Plasmid#110647Purposeexpresses a PAR-binding (PBZ) domain fused to venus N-terminus, contains point mutations that abolish PAR bindingDepositorInsertPBZ domain from APLF, amino acids 371-451 (APLF Human)
TagsDDK and VNExpressionMammalianMutationC379A, C385A, C421A and C427APromoterCMVAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSICO-CPSF6-358-eGFP
Plasmid#110693PurposeExpresses a truncated form of CPSF6 (CPSF6-358 originally described in Lee et al. Cell Host Microbe 2010) fused with eGFPDepositorInsertCPSF6-eGFP (CPSF6 )
UseLentiviralTagsEGFPMutationTruncation of CPSF6 isoform 2 at amino acid 358Available SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK-enhNC1.1_M3-MCS-2A-eGFP-SV40pA
Plasmid#110203PurposeRecipient vector for Cranial Neural Crest-specific expression of protein of interestDepositorInsertenhNC1.1_M3-TF_MCS-2A-eGFP-SV40pA
TagseGFPExpressionBacterialAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSKC12 - DelQ
Plasmid#110493PurposeMonitor the expression of Luciferase driven by a mutated NRAS 5'-UTR.DepositorInsertNRAS 5'- DelQ (bp 30-254) (NRAS Human)
UseLuciferaseTagsFirefly luciferaseMutationDeletion of the first 29 base pairs of the NRAS 5…PromoterT7Available SinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-IV-3xFLAG/HA/NBL10
Plasmid#110568PurposeCre-dependently expresses large ribosomal subunit protein RPL10A with a 3xFLAG/HA tagDepositorInsert3xFLAG/HA-tagged anti-GFP VHH
UseAAV, Cre/Lox, and Synthetic BiologyExpressionMammalianPromoterEF1aAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1RA-P2A-Puro
Plasmid#110853PurposeLentiviral vector for constitutive expression of Cas9-HF1RA in mammalian cells (codon optimized)DepositorInsertCas9-HF1RA
UseLentiviralTagsFLAGMutationR661A, Q695A, Q926A, and NLS sequence at the N-te…PromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-BE3RA-P2A-Puro
Plasmid#110839PurposeLentiviral vector for constitutive expression of BE3RA in mammalian cells (codon optimized)DepositorInsertBE3RA
UseLentiviralMutationD10APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGAC
Plasmid#110423PurposeshGAC, silence glutaminase GAC isoform, doxycycline inducible, puromycin selectionDepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human USP30 (64-502, construct 13, MG-26-82)
Plasmid#110746PurposeBacterial expression of human USP30 (construct 13)DepositorInsertUSP30 (USP30 Human)
TagsN-His6-3C-GST-3CExpressionBacterialMutationF348D, M350S, I353E + insertion deletion: 64-178;…PromoterT7Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#121
Plasmid#110879PurposeExpresses the C. elegans unc-31 cDNA pan-neuronallyDepositorInsertsrab-3 promoter
unc-31 cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationMissing first 408bpAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMINTC3GH (Kan)
Plasmid#110076PurposeAnalogous to pMINTNH3 but with a C-terminal 3C cleavage site and a GFP-His10 tag fusion.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MyosinVb-Ctail
Plasmid#110170PurposeDominant negative effect by competing with MyosinVb C-terminal tail interactionsDepositorInsertMyosin Vb (Myo5b Rat)
TagsEGFPExpressionMammalianMutationamino acids 1262-1670PromoterCMVAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCBe
Plasmid#110065PurposeTrc1O promoter express gene in Synechocystis 6803DepositorTypeEmpty backboneTags3' end His tag and 5' end FLAG tagExpressionBacterialPromoterTrc1OAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
hCCR5-mTFP1
Plasmid#110193PurposeEncodes for human CCR5 coding sequence tagged with the mTFP1 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 HRPT2 136X
Plasmid#11049DepositorInsertHRPT2 136X (CDC73 Human)
TagsflagExpressionMammalianMutationtruncation mutant with a stop codon introduced at…Available SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
p156 pWZL-EGFP-SLPI
Plasmid#11069DepositorAvailable SinceDec. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 A242V
Plasmid#11022DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_DLG2_PDZ_2
Plasmid#110000PurposeProtein expression and purification of DLG2_PDZ_2DepositorInsertDLG2_PDZ_2 (DLG2 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only