We narrowed to 11,270 results for: cat.1
-
Plasmid#224780PurposePichia pastoris expression vector for generating mouse TREK-1(21S-322T) + 3C cleavable site + eGFP + 10x His under the AOX1 promoterDepositorInsertPotassium channel subfamily K member 2 (Kcnk2 Mouse)
ExpressionYeastMutationK84R / Q85E / T86K / I88L / A89R / Q90A / A92P / …PromoterAOX1 promoterAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-pEGFP(isoform 1)
Plasmid#99561Purposemammalian expression of TMEM230-GFP (isoform 1)DepositorAvailable SinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
TMEM230-WT-IRES(isoform 1)
Plasmid#99558Purposemammalian expression of TMEM230 (isoform 1) and ZsGreenDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDRM55 tet-AR(1-707)
Plasmid#183503PurposeLentiviral vector expressing a doxycycline-inducible constitutively active truncated androgen receptor (wild type AR)DepositorInsertAndrogen receptor (AR Human)
UseLentiviralExpressionMammalianMutationConstitutively active truncated AR; spans AR 1-70…PromoterCMVAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEEF1D-FLAG (pcDNA 3.1+) LG6-1
Plasmid#37365DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFLAG-EEF1D (pcDNA 3.1+) LG3-1
Plasmid#37364DepositorAvailable SinceJuly 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
MG1655-OptoCre-cat-T172A-P-R
Bacterial Strain#188480PurposeCre-inducible activation of catT172Afor chloramphenicol resistance.DepositorBacterial ResistanceNoneAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam APC 1-2644
Plasmid#16511DepositorAvailable SinceApril 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam APC 1-1309
Plasmid#16509DepositorAvailable SinceApril 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam APC 1-1941
Plasmid#16510DepositorAvailable SinceApril 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam APC 1-331
Plasmid#16508DepositorAvailable SinceApril 30, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChR2(H134R)-eYFP (AAV PHP.eB)
Viral Prep#127090-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-CAG-DIO-ChR2(H134R)-eYFP (#127090). In addition to the viral particles, you will also receive purified pAAV-CAG-DIO-ChR2(H134R)-eYFP plasmid DNA. CAG-driven, Cre-dependent expression of humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEYFP (Cre-dependent)Available SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro-humanU6-shRNA FASN
Plasmid#82327Purposeused to silence target human FASN expression via RNA interference (3rd gen lentiviral vector)DepositorInsertshRNA to target Fatty Acid Synthase (FASN) (FASN Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
GSE22 T329A in pENTR1A (w187-1)
Plasmid#22253DepositorInsertGenetic suppressor element #22, T329A
UseEntry vectorMutationThreonine 329 is mutated to Alanine (p53 nomencat…Available SinceDec. 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
Munc13-1 mScarlet1 twin strep
Plasmid#245007PurposeProtein purification and distribution and localization of rat wild-type Munc13-1 in cellsDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
XE133 dnWnt-1 myc CS2+
Plasmid#16859DepositorInsertdnWnt-1 myc CS2+ (Wnt1 Mouse)
UseXenopus expressionTagsmycMutationWnt-1 gene is truncated after the SPNFC peptide s…Available SinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-G protein gamma-1
Plasmid#67038PurposeG protein gamma-1 tagged with HaloTag on amino terminusDepositorAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28-Flag-RBM24-1~93
Plasmid#208633Purposefor E. coli expression of truncated Flag tagged human RBM24 (ENST00000379052), aa1~93DepositorInserthuman RBM24 (ENST00000216146) aa 1~93 (RBM24 Human)
Tags6xHis and FlagExpressionBacterialMutationonly aa 1~93, other residues not includedPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag-G protein beta-1
Plasmid#67016PurposeG protein beta-1 tagged with HaloTag on amino terminusDepositorAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only