We narrowed to 27,842 results for: gfp
-
Plasmid#65531PurposePlasmid for Bxb1-mediated recombination of the GFP-Dnmt3b1 cDNA into a MIN-tagged locusDepositorInsertDnmt3b (Dnmt3b Mouse)
UseMouse Targeting; Bxb1TagsGFPExpressionMammalianMutationisoform 1Available sinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-p65
Plasmid#183929PurposeOptogenetic PHR domain coupled to GFP and p65 activation domain; binds to CIBN upon blue light exposureDepositorAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hsRPA14 (MSW#503)
Plasmid#208069PurposeExpression of GFP-tagged hsRPA3 in human cellsDepositorAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL-GFPGO-PGK-Neo
Plasmid#136890PurposeLentivirus for base editing activatable GFP expression in mammalian cellsDepositorInsertGFPGO
UseLentiviralMutationATG>ACGPromoterSFFVAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-p19Ink4d-IRES-GFP
Plasmid#52221Purposeretroviral bicistronic expression of p19Ink4d and GFPDepositorAvailable sinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLP_mod_mNeonGreen11_P2A_puroR_CRE-GFP
Plasmid#229227PurposeModular BxB1 landing pad vector containing C-term mNeonGreen11 tag, puroR marker, and a cAMP GFP reporter.DepositorTypeEmpty backboneTagsmNeonGreen11ExpressionMammalianAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-msfGFP
Plasmid#180322Purposemammalian expression of human SEPT9_i3 fused to monomeric superfolder GFPDepositorAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS405 VAC8-GFP
Plasmid#166836PurposeExpresses Vac8-GFP in yeasts.DepositorAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Rim2
Plasmid#170869PurposeMammalian expression of His-GFP-Rim2.DepositorInsertRegulating synaptic membrane exocytosis protein 2 (Rim 2) (Rims2 Rat)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-sGFP-Vrg4
Plasmid#160904PurposeExpresses GFP-Vrg4 in yeast cellsDepositorInsertVRG4
TagsGFPExpressionYeastAvailable sinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-GFP-dSUMO
Plasmid#85696Purposeexpression of GFP-SUMO1 in Drosophila cellsDepositorAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA3-Xl-VSP1-GFP
Plasmid#51883Purposeexpression of Xl-VSP1 -GFP fusion in Xenopus oocytes or mammalian cellsDepositorAvailable sinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-C1-FLAG-GFP-Ubl4A
Plasmid#86921PurposeTo express Ubl4A tagged with FLAG-EGFP at N- terminus.DepositorAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2_BeYDV geminino 2.0 (no ATG)-eGFP (GB5178)
Plasmid#225443PurposeGeminino 2.0-no ATG on CDS. BeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1.DepositorInsertBeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMH-EF1-GFP
Plasmid#133018Purpose(Empty Backbone) Gateway-compatible destination vector for mammalian expression of N-terminal GFP protein under EF1 promoter.DepositorTypeEmpty backboneTagsGFPExpressionMammalianPromoterEF1Available sinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR_UAS-tTS-P2A-GFP_PGK-BFP
Plasmid#133808Purposeinducible expression of tTS and GFP with BFP marker in mammalian cellsDepositorInserttTS-P2A-EGFP-PGK-BFP
UseLentiviralExpressionMammalianAvailable sinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRRL-GFPGO2(NGG)-PGK-Neo
Plasmid#136891PurposeLentivirus for base editing activatable GFP expression in mammalian cellsDepositorInsertGFPGO2(NGG)
UseLentiviralTags2xNLSMutationATG>ACGPromoterSFFVAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTFCP2-donor
Plasmid#112308PurposeCRISPR donor plasmid to tag human transcription factor TFCP2 with GFPDepositorInsertTFCP2 homology arms flanking EGFP-IRES-Neo cassette (TFCP2 Human)
UseCRISPRAvailable sinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12-donor
Plasmid#113802PurposeCRISPR donor plasmid to tag human transcription factor ZBTB12 with GFPDepositorInsertZBTB12 homology arms flanking EGFP-IRES-Neo cassette (ZBTB12 Human)
UseCRISPRMutationrs9267664, rs9267663Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only