We narrowed to 10,232 results for: gnas
-
Plasmid#213271PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only
-
GPR160-DuET
Plasmid#213268PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPBA-DuET
Plasmid#213255PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
FPR2-DuET
Plasmid#213240PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
CYSLTR2-DuET
Plasmid#213226PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
ADRB1-DuET
Plasmid#213180PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
SUMO-Twinkle 43-372
Plasmid#205054PurposeTWNK protein expressionDepositorInsertTWNK (TWNK Human)
ExpressionBacterialMutationLacks Mitochondrial localization signal and C ter…Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EFNB2 (D62Q)
Plasmid#200976PurposeMammalian expression plasmid for myc-tagged EFNB2 (D62Q specificity mutant)DepositorInsertEFNB2 (EFNB2 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationD62Q (increases specificity towards henipaviral G…PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-bio-myc-mCE 211-597
Plasmid#112716PurposeExpresses N-terminally bio-myc-tagged mouse CE/Rngtt 211-597 in mammalian cellsDepositorInsertRngtt (Rngtt Mouse)
Tagsbiotinylation signal peptide (Tagwerker et al. 20…ExpressionMammalianMutationdeleted amino acids 2-210 (triphosphatase domain)PromoterCMVAvailable SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-Nb127D01-mCherry-KDEL
Plasmid#171575PurposeExpresses mCherry-tagged anti-CXCR2 (human) recombinant llama nanobody (Nb127D01-mCherry) in fly cell ER membraneDepositorInsertBiP-Nb127D01-mCherry-KDEL (CXCR2 Human)
TagsBiP signal peptide and mCherry-KDELExpressionInsectPromoterfly actin5C promoterAvailable SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAW-BiP-NbVHH05-mCherry-KDEL
Plasmid#171574PurposeExpresses mCherry-tagged anti-UBC6e (human) recombinant alpaca nanobody (NbVHH05-mCherry) in fly cell ER membraneDepositorInsertBiP-NbVHH05-mCherry-KDEL (UBE2J1 Human)
TagsBiP signal peptide and mCherry-KDELExpressionInsectPromoterfly actin5C promoterAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GFP-EBA175-Flag(E1418K/A1419R/S1421R/P1424Q/Y1426S)
Plasmid#155010PurposeExpresses N-terminally GFP-tagged and C-terminally Flag-tagged EBA175 E1418K/A1419R/S1421R/P1424Q/Y1426S variant (residues 1284-1462) from pcDNA3.1DepositorInsertPfEBA175
TagsFlag, GFP, and signal peptide (residues 1 to 32) …ExpressionMammalianMutationE1418K/A1419R/S1421/P1424Q/Y1426S; insert codes f…PromoterCMVAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-TOM20MTS-DDRGK1-dTM-HA
Plasmid#139861PurposeLentiviral expression of TOM20MTS-DDRGK1-dTM-HADepositorInsertTOM20-MTS-DDRGK1-dTM (DDRGK1 Human)
UseLentiviralTagsHAMutationrecombinant fusion of mitochondria-targeting sign…Available SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [ArchT-tdTomato]
Plasmid#123607PurposeAAV mediated expression of ArchT-tdTomato under the Syn promoter, in floxed/reversed (Cre-dependent) manner. tdTomato has codons varied to reduce recombination. Using bGHpA signal.DepositorInsertArchT-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterSynAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Rescue myc-PCDHGC5 mRNA
Plasmid#122229PurposeRescue mRNA for Protocadherin gamma C5 knock down with sh1 shRNA (plasmid 122227). With five silent mutations at sh1 shRNA target site.DepositorInsertPCDHGC5 (Pcdhgc5 Rat)
Tags9E10 cMyc epitope (EQKLISEEDL) was inserted betwe…ExpressionMammalianMutationSilent mutations are in five consecutive codons …Available SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Chronos-tdTomato]
Plasmid#84484PurposeAAV-mediated expression of Chronos-tdTomato under the CAG promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal. tdTomato is a codon diversified version.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterCAGAvailable SinceApril 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only