We narrowed to 1,679 results for: CAG promoter
-
Plasmid#184610PurposeFor expression of a fluorescent sensor for neuromedin B in mammalian cellsDepositorInsertMTRIA-NMB
ExpressionMammalianPromoterCAG promoterAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIE043 ZF43x1 mKate2 (TUPV1)
Plasmid#138723PurposemMoClo TUPV, with ZF43x1 promoter and mKate2 in the MCSDepositorInsertZF43x1
UseSynthetic BiologyExpressionMammalianPromoterZF43x1Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE042 ZF43x0 mKate2 (TUPV1)
Plasmid#138722PurposemMoClo TUPV, with ZF43x0 promoter and mKate2 in the MCSDepositorInsertZF43x0
UseSynthetic BiologyExpressionMammalianPromoterZF43x0Available SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_mEmerald_I3
Plasmid#231681PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with two tandem mEmeralds in mammalian cells. Assembles into nanocages tagged with 120 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmEmerald_I3
Plasmid#231680PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with one mEmerald in mammalian cells. Assembles into nanocages tagged with 60 mEmerald FPs.DepositorInsertI3-01
TagsmEmeraldExpressionMammalianMutationK129APromoterCMVAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGG184
Plasmid#165604PurposeReporter plasmid for B1H-dependent expression of the HIS3/GFP operon with a single hEGFP protospacer: PS1(upstream of promoter with 'CAGCG' PAM)-lac-HIS3 and GFPDepositorInserthEGFP protospacer ('CAGCG' PAM) upstream of the HIS3/GFP promoter
UseSynthetic BiologyExpressionBacterialMutation'CAGCG' PAM replacing the 'CGGCG…PromoterlacAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pstb-LAFR5
Plasmid#86169PurposepLAFR5 with Smb21651 promoter. pLAFR5 is a broad-host range cosmid vector with double cos sites.DepositorTypeEmpty backboneExpressionBacterialPromoterSMb21651 promoterAvailable SinceFeb. 6, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
p304N
Plasmid#246317PurposePlant CRISPR editing with the experimentally validated Medicago truncatula MtU6.6 promoter (352 bp)DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCLYBL-Neo_TRE3VG_mCherry_Responder
Plasmid#230054PurposeIt presents the TRE3VG inducible promoter allowing the dox-dependent inducible activation of mCherry through the OPTi-OX platform. The CLYBL GSH supports higher transgene expressionDepositorInsertTRE3VG_mCherry
ExpressionMammalianPromoterTRE3VGAvailable SinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEMS1277
Plasmid#29140PurposePlasmid described in Yang et al., Genomics, 2009 (PMID: 18950699).DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSAvailable SinceSept. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1157
Plasmid#29072PurposePlasmid described in Yang et al., Genomics, 2009 (PMID: 18950699).DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSAvailable SinceJan. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1293
Plasmid#29144DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsCreAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1164
Plasmid#29079DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-CreAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1114
Plasmid#29043DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceDec. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1488
Plasmid#29239DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1294
Plasmid#29145DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK389
Plasmid#206791PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNADepositorInsertsdCas9
MCP-SoxS
scRNA
PromoterJ23119 and TetAvailable SinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only