We narrowed to 27,842 results for: gfp
-
Plasmid#164229Purposelentiviral plasmid for GFP-hTREX1 delta C (aa1-235)DepositorInsertTREX1 (TREX1 Human)
UseLentiviralTagsGFPExpressionMammalianMutationdeleted amino acids 235-314PromoterCMVAvailable sinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUSE-URA3-Sec7-msYFP2
Plasmid#218969PurposeGene replacement plasmid to label S. cerevisiae Sec7 with msYFP2DepositorAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT- eef1a1l1:sfGFP
Plasmid#254856PurposeThis plasmid is designed for Tol2-mediated transgenesis in zebrafish and drives ubiquitous cytoplasmic expression of superfolder GFP (sfGFP), under the control of an eef1a1l1 derived promoter.DepositorInserteef1a1l1 (eef1a1l1 Zebrafish)
Promotereef1a1l1Available sinceJuly 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.ARID3a.IRES.GFP
Plasmid#169300PurposeConstitutive overexpression of human ARID3A cDNA with GFP as reporter fluorescent proteinDepositorAvailable sinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
ERrefGFP1_pCDNA3
Plasmid#48635PurposeMam vector encoding for the ER targeted and FLAGM1 tagged insensitive variant of fluorescent redox probe roGFPiE with mut Cys147 to Ser, del insertion147b and mut Cys204 to Glut.Referred to as ref GFPDepositorInsertERrefGFP1
TagsFLAGExpressionMammalianMutationC147S,C204QAvailable sinceOct. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
LV TRE-GFP-TMD-DLL1
Plasmid#194936PurposeLV construct encoding GFP-TMD-DLL1 ligand under dox-inducible TRE promoter and containing a PGK-rtTA-M2-IRES-Puro regulator/resistance marker cassette.DepositorInserteGFP-(PDGFR)TMD-rDLL1 ICD (WT)
UseLentiviralAvailable sinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-PI4KB
Plasmid#221759PurposeStable expression of GFP-PI4KB in mammalian cellsDepositorAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-2xFYVE
Plasmid#221750PurposeStable expression of GFP-2xFYVE in mammalian cellsDepositorInserttandem HRS FYVE domain
UseRetroviralTagsGFPExpressionMammalianMutationtwo FYVE domains (amino acids 147-223), linked by…Available sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC101-GFPmut2(ΔmScarlet)
Plasmid#208185PurposeGFP positive, mScarlet-I negative controlDepositorInsertGFPmut2
UseReporterExpressionBacterialPromoterPtet+dnaK P1Available sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGFP-p62 var2
Plasmid#204575PurposeExpresses GFP-p62 var2 in mammalian cellsDepositorAvailable sinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK1
Plasmid#197108PurposeExpression of GFP-tagged TAOK1 / PSK2 in mammalian cellsDepositorAvailable sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-2A-GFP-IRESpuro2
Plasmid#183746PurposeExpresses H2B-2A-GFPDepositorInsertH2B (H2BC16P Human)
TagsGFP with 2A protease cleavage site between H2B an…ExpressionBacterial and MammalianPromoterCMVAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Avr2-GFP pZK538
Plasmid#118011Purposeexpresses Avr2-GFP (without signal peptide) and mCherry-HDEL. Used for visualization of cell-to-cell movement of Avr2. Avr2 can be replaced with gene of interest via HiFi DNA assembly cloning (NEB) .DepositorPublicationInsertsdspAvr2
mCherry
TagsEGFP and HDELExpressionBacterial and PlantPromoter35SAvailable sinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJUNB.1.0-gDNA
Plasmid#112409PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor JUNBDepositorAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKin1A
Plasmid#31607DepositorAvailable sinceOct. 4, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLX-EF1a_NKX2-1_Short_V5-GFP
Plasmid#221497PurposeNKX2-1-GFP fusion protein lentiviral overexpression using an EF1a promoterDepositorAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pME-QUAS5x:GFPNLS-SV40pA
Plasmid#155115PurposeMiddle entry vector containing QUAS5x element upstream of GFP-NLS.DepositorInsertQUAS5x:GFPNLS
UseGateway middle entry vectorPromoterQUAS5x-E1bAvailable sinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only