We narrowed to 1,530 results for: CAG promoter
-
Plasmid#72919Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving GFPDepositorInsertchicken green opsin promoter
UseTagsExpressionMutationPromoterAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Rem2-2
Plasmid#51595PurposeshRNA 2 against rodent Rem2DepositorAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #409 (Sa)
Plasmid#98134PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #409
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
hIRF-1 gRNA #351 (Sa)
Plasmid#105283PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 systemDepositorInsertgRNA_hIRF1 promoter #351
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
Gg 3kb Green opsin DsRed
Plasmid#72918Purposegreen opsin promoter from chicken (Gallus gallus) gDNA chr26:4,504,913–4,501,931 in galGal4 driving DsRedDepositorInsertchicken green opsin promoter
UseTagsExpressionMutationPromoterAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA-puro
Plasmid#180426PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.DepositorInsertgRNAscr
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhuman U6Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralTagsExpressionMutationPromoterAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4405
Plasmid#115466PurposeConstitutive lentiviral expressionDepositorInsertshCELF4-4405 (CELF4 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG/Rosa26
Plasmid#105510PurposeLentiviral expression of Rosa26 targeting sgRNADepositorAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL3-9465
Plasmid#115464PurposeConstitutive lentiviral expressionDepositorInsertshMBNL3-9465 (MBNL3 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable SinceOct. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
UseTagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh1
Plasmid#127650PurposeKnock-down of human NONODepositorAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
shERK2a-mlpx-puro
Plasmid#65229Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330 p300 gRNA
Plasmid#165591PurposeInsertion of p300 degronDepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RNF34
Plasmid#119937PurposeRING finger protein 34 expressionDepositorAvailable SinceMarch 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - DDX3Y sgRNA 1
Plasmid#70656PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against DDX3Y
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX198
Plasmid#89262PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01DepositorInsertOsPDS-gRNA01
UseCRISPRTagsSV40 NLSExpressionPlantMutationPromoterMaize Ubiquitin1 promoterAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 1
Plasmid#70655PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - C9orf114 sgRNA 2
Plasmid#70654PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsgRNA against C9orf114
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTX203
Plasmid#89267PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02DepositorInsertOsDEP1-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantMutationPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only