-
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pB-puro-mU6-CNPsgRNA
Plasmid#126610PurposeExpresses CNP sgRNA under mouse U6 promoterDepositorInsertCNP sgRNA (Cnp Mouse)
UseCRISPRTagsExpressionMutationPromotermouse U6 promoterAvailable sinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9TagsExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available sinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterhU6 and hU6-2xTetOAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-GT
Plasmid#40025DepositorInsertsGFP
beta-globin intron
Neo
tdT-3Myc
diphteria toxin A
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta globin promoter and CMV enhance…Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
DHFR-mNeon-GluA1
Plasmid#173009PurposeFor light regulated release of GluA1 from the endoplasmic reticulum. Driven by synapsin promoter. Intracellular trafficking can be better visualized with mNeon.DepositorInsertDHFR-mNeon-GluA1
UseTagsDHFR and mNeonExpressionMammalianMutationPromoterChicken beta actin (CAG)Available sinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBT268_(pCA-ATG-intron-tTA2-iiTRE-tdT3Mycii)
Plasmid#36880DepositorInsertstTA2
tdT-3Myc
insulator
UseTags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-G-intron(Neo)-T(FLLFLNL)
Plasmid#40020DepositorInsertsGFP
tdT-3Myc
beta-globin intron
Neo
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta globin promoter and CMV enhance…Available sinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT250_(pCA-G-intron(Neo)-tTA2)
Plasmid#36876DepositorInsertsGFP
tTA2
beta-globin intron
Neo
UseTagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-G-intron(Neo)-T(LNL)
Plasmid#36907DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
UseTags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available sinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
UseTagsExpressionInsectMutationPromoterU6-3Available sinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-1
Plasmid#193694PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shPRDM14-4
Plasmid#193697PurposeConstitutive lentiviral expression of PRDM14 shRNADepositorInsertPRDM14 (PRDM14 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only