We narrowed to 10,569 results for: fus
-
Plasmid#195158Purposemammalian expression of ER localized ABHD16A tagged with mNeonGreenDepositorInsertStim1NTD (STIM1 Human)
TagsABHD16A cytoplasmic domain and mNeonGreenExpressionMammalianMutationNonePromoterCMVAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2393-Tier1-PhCMV-p2a_fastFT
Plasmid#169530PurposeTier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "fast" maturation fastFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).DepositorInsertPCMV-driven P2A-fused fluorescent timer, fast maturation time
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-GB1-EWS_171-264
Plasmid#180466PurposeExpresses the construct His8-GB1-EWS_171-264 with a TEV cleavage site between GB1 and EWS_171-264DepositorInsertEWSR1 (EWSR1 Human)
TagsGB1 and His8ExpressionBacterialMutationdeleted 1-170, 265-656PromoterT7Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-GFP-EWS_1-120
Plasmid#180464PurposeExpresses the construct His8-GFP-EWS_1-120 with a TEV cleavage site between GFP and EWS_1-120DepositorInsertEWSR1 (EWSR1 Human)
TagsGFP and His8ExpressionBacterialMutationdeleted 121f-656PromoterT7Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG8H-sumo-EWS_91-199
Plasmid#180465PurposeExpresses the construct His8-sumo-EWS_91-199DepositorInsertEWSR1 (EWSR1 Human)
TagsHis8 and SUMOExpressionBacterialMutationdeleted 1-90, 200-656PromoterT7Available SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2392-Tier1-PhCMV-p2a_medFT
Plasmid#169529PurposeTier-1 vector encoding PhCMV-driven delayed-maturing fluorescent protein fluorescent timer (FT) with "medium" maturation medFT fused to a "self-cleaving" peptide p2a (PhCMV-p2a_medFT-pA).DepositorInsertPCMV-driven P2A-fused fluorescent timer, medium maturation time
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2388-Tier1-PhCMV-p2a_Ypet
Plasmid#169525PurposeTier-1 vector encoding PhCMV-driven yellow fluorescent protein YPet fused to a "self-cleaving" peptide p2a (PhCMV-p2a_YPet-pA).DepositorInsertPCMV-driven P2A-fused yellow fluorescent protein Ypet
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2389-Tier1-PhCMV-p2a_mRuby
Plasmid#169526PurposeTier-1 vector encoding PhCMV-driven red fluorescent protein mRuby2 fused to a "self-cleaving" peptide p2a (PhCMV-p2a_mRuby2-pA).DepositorInsertPCMV-driven P2A-fused enhanced yellow fluorescent protein
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
MUM2SP-Citrine
Plasmid#181963PurposeMUM2 signal peptide fused to Citrine, under control of MUM4_1.5kb promoterDepositorInsertMUM2 signal peptide, fused to the Citrine YFP in pAD
TagsCitrine YFPExpressionPlantPromoterMUM4pro 1.5kb fragmentAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG660 lyn11-pFAST
Plasmid#172863Purposeexpresses lyn11-pFAST in mammalian cells (inner membrane labeling)DepositorInsertLyn11-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDTCendoNA2
Plasmid#174732PurposeExpresses DT386C-endoNA2 fusion protein for selective elimination of polysialic acid–containing cells. Truncated diphtheria toxin fused to noncatalytic endosialidase via a caspase-3/7-cleavable linkerDepositorInsertDT386C
ExpressionBacterialMutationDeleted amino acids 412-560 (the receptor binding…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF197
Plasmid#101547PurposeDonor Vector containing ZNF197 transcription factor, part of the Human TFome CollectionDepositorInsertZNF197 (ZNF197 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXE1
Plasmid#101439PurposeDonor Vector containing FOXE1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXE1 (FOXE1 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
C514-E51: attB5r-RBS-His6-MBP-nostop-attB1r
Plasmid#162964PurposeGateway attB5r/attB1r entry clone for generation of N-terminal His6-MBP-tagged fusion proteins in bacterial expressionDepositorInsertHis6-Maltose-binding protein fusion tag with upstream E. coli ribosome binding site
UseSynthetic BiologyAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim-DC2-H2B2-Venus
Plasmid#129556PurposepClimDC-H2B:mV nuclear markerDepositorInsertHistone 2B fused to venus
ExpressionBacterialAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB6-Lrig1-T2A-tdTomato-FNF-TK
Plasmid#134320PurposeB6J Lrig1-T2A-tdTomato allele targeting vector, low copy numberDepositorAvailable SinceMarch 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGAD-Atg17(L313D I314K)
Plasmid#121390PurposeFor Yeast-two-hybrid analysisDepositorInsertATG17
ExpressionYeastMutationLeucine 313 to Aspartic acid; Isoleucine 314 to L…PromoterADH1 promoterAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLP338 pEF1a-DACH1-1-SunTag
Plasmid#100942PurposeTALE vector with DACH1-1 insert fused to SunTagx10, driven by EF1a, with 3xHA tag, no PURO geneDepositorInsertTALE target sequence for DACH1, SunTag array (10xGCN4)
UseTALENTags3xHAExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN19-ccvTIR1-GUS-NOSt
Plasmid#108548PurposeCloning vector including C-terminally GUS-tagged Arabidopsis auxin receptor TIR1 with the F79G mutation [ccvTIR1] and NOS terminatorDepositorInsertTRANSPORT INHIBITOR RESPONSE 1 fused with GUS and NOS terminator (TIR1 Mustard Weed)
UseCloning vectorTagsGUSMutationChanged F79 to GAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only