173,005 results
-
Plasmid#32667DepositorAvailable SinceNov. 28, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pEHAC1-CHIP-BirA-HA
Plasmid#232587PurposeExpress BirA tagged to the C-terminus of CHIP.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB CAG-tdTomato
Plasmid#133569PurposeCAG tdTomato piggyBac transposonDepositorInserttdTomato
ExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMM146
Plasmid#127218PurposeBeYDV replicon with constitutive Luc expression, BBM, sgRNA targeting PDSDepositorInsertLuc, BBM, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
p4xACO-Luc
Plasmid#16533DepositorInsert4xACO
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Centrobin
Plasmid#136829PurposeMammalian expression of the centrosomal protein Centrombin N-terminally fused to SNAP-tagDepositorInsertSNAP-Centrobin (CNTROB Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_UAS-Ecad
Plasmid#133804Purposeinducible expression of Ecad in mammalian cellsDepositorAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gagust
Plasmid#196054PurposeEncodes a G alpha subunit (GNAT3) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-NpHR3.3-EYFP (AAV8)
Viral Prep#137151-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-NpHR3.3-EYFP (#137151). In addition to the viral particles, you will also receive purified pAAV-nEF-NpHR3.3-EYFP plasmid DNA. nEF-driven expression of NpHR3.3-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFPAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple GaZ
Plasmid#196053PurposeEncodes a G alpha subunit (GNAZ) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
PEmax-mRNA
Plasmid#204472Purposeplasmid for PEmax mRNA IVTDepositorInsertPrime editor
UseCRISPRTagsnoExpressionMammalianPromoterT7Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
9xHRE-MinTK-CRE
Plasmid#141146Purposelentiviral expression vector to generate a hypoxia fate-mapping systemDepositorInsert9xHRE-MinTK-CRE
UseLentiviralAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-MBP
Plasmid#72323PurposeBacterial expression of Maltose Binding Protein linked to SnoopTag, a peptide tag forming a spontaneous covalent bond with its protein partner Snoopcatcher.DepositorInsertpET28a SnoopTag-MBP
TagsN-terminal His6 tag. MBP is fused at the C-termin…ExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc-his-BACH1 WT
Plasmid#17642DepositorAvailable SinceApril 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRG2
Plasmid#104174PurposesgRNA expressionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICH50881
Plasmid#48045DepositorTypeEmpty backboneUseUnspecifiedAvailable SinceDec. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLminP_Luc2P_RE17
Plasmid#90359PurposeNFAT - PKC/Ca++ gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterNFATAvailable SinceAug. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEXC3GH (Kan)
Plasmid#110081PurposeAnalogous to pMINTC3GH but containing oriM for episomal replication in mycobacteria.DepositorTypeEmpty backboneTags3C cleavage site - GFP - His10 TagExpressionBacterialAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
ERBB3 gRNA (BRDN0001147088)
Plasmid#77481Purpose3rd generation lentiviral gRNA plasmid targeting human ERBB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only