We narrowed to 32,681 results for: promoter
-
Plasmid#129503PurposeExpresses AausGFP constitutively in E. coli (most strains)DepositorInsertAausGFP
ExpressionBacterialPromotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-T7-EcKlenow (LM2692)
Plasmid#208963PurposeUnfused EcKlenow DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-SIRT2-Flag
Plasmid#102624PurposeExpresses full length SIRT2 isoform 1 in mammalian cellsDepositorAvailable SinceJan. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-VRQR-P2A-EGFP (RTW3161)
Plasmid#139992PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-VRQR(D1135V/G1218R/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-VRQR with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationVRQR=D1135V/G1218R/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh3
Plasmid#69042PurposeLentiviral expression of IKZF1 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG FBXO31
Plasmid#236429Purposetransient overexpression of FBXO31 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2K7-bsd-UBI-tagRFP-KDEL
Plasmid#114179PurposeLentiviral vector for expression of tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseLentiviralTagsKDEL retention signal and signal peptideExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
7TFP CDH1 mutant reporter
Plasmid#91703Purposelentiviral luciferase reporter containing CDH1 promoter with mutant E-boxesDepositorInsertCDH1 mutant promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianMutationmutant E-boxesPromoterCDH1 mutantAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgTrack-BFP
Plasmid#164273PurposeEmpty sgRNA expression vector with co-expression of BFP reporterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EFSAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-tagRFP-KDEL
Plasmid#114177PurposeGateway entry clone containing tagRFP with a signal peptide and KDEL ER retention signal for expression of tagRFP in the ERDepositorInserttagRFP-KDEL
UseGateway entry cloneTagsKDEL retention signal and signal peptideAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
scaffold-linker-U6
Plasmid#89639Purposeconstruction of paired sgRNAs driven by two U6 promoters. Vector itself only has one U6 promoter.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterhU6Available SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC57-4eCOL2A1
Plasmid#97211PurposeFor cloning of a COL2A1-based, chondrogenesis-responsive promoter, and subcloning this insert into new vectorsDepositorInsert4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37) (COL2A1 Human)
UseVector is designed for cloning and generation of …PromoterCOL2A1 regulatory elementsAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral-His-tagged-PSPH
Plasmid#134786PurposeStable overexpression lentiviral vector of His tagged PSPHDepositorAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-hBMPR-1A CA
Plasmid#49527Purposeexpresses constitutively active human BMP receptor 1ADepositorInsertBMPR-1A CA (BMPR1A Human)
ExpressionMammalianMutationconstitutively active mutation (Q233D); also P2A …PromoterCMVAvailable SinceMay 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLX317 SLC2A1
Plasmid#193685PurposeConstitutive lentiviral expression of SLC2A1DepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
416 pSG5L HA RB del22
Plasmid#10721DepositorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
6691 Bicistronic_ires_puro
Plasmid#64335PurposeThis a retroviral expression plasmid with a minimal polylinker followed by IRES and puro resistance geneDepositorTypeEmpty backboneUseRetroviralAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-FKBP12_F36V-SpdCas9-KRAB-tagBFP-PGK-Blasticidin
Plasmid#187953PurposeFKBP12 (F36V mutant) degron-tagged dCas9-KRAB domain fused to tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertFKBP12_F36V-SpdCas9-KRAB-tagBFP
UseCRISPR and Synthetic BiologyTagsGGSExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
plenti-UBC- IRF4-3xHA-pGK-PUR
Plasmid#107386PurposeLentiviral expression of IRF4-3xHADepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only