We narrowed to 5,962 results for: crispr cas9 expression plasmids
-
Plasmid#69228PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS2 in mammalian cellDepositorInsertTS2 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS-ZFP_TS4
Plasmid#69230PurposeExpresses R1335K mutant SpCas9 fused to ZFP-TS4 in mammalian cellDepositorInsertTS4 ZFP
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pED9x (dCas9-KRAB-mCherry)
Plasmid#163956PurposeLentiviral expression plasmid of sgRNA with mCherryDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER dCas9-TET1CDMut
Plasmid#101920PurposeThe dCas9-TET1CDMut fusion protein is cloned into the pINDUCER lentiviral backbone (Addgene plasmid# 46948). The TET1 catalytic domain is mutated to abolish catalytic function.DepositorInsertdCas9-TET1CD Mut
UseLentiviralExpressionMammalianMutationMutated TET1 catalytic domainAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pattB-LSL-AAVR-F2A-spCas9
Plasmid#202459PurposeThe plasmid backbone used to generate the recombination template to generate the SELECTIV mice through Integrase Mediated Transgenesis. Allows for Cre-dependent expression of AAVR and Cas9.DepositorInsertAAVR (AU040320 Mouse)
UseCRISPR, Cre/Lox, and Mouse TargetingTagsmCherry fusionExpressionMammalianPromoterCAGAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
evoFERNY-Cas9NG
Plasmid#203329PurposePlasmid for bacterial purification of codon optimized evoFERNY-Cas9NGDepositorInsertevoFERNY-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfABC1D-SaCas9-WPRE3-pA
Plasmid#203540PurposeSaCas9 expression in astrocytesDepositorInsertSaCas9
UseAAVExpressionMammalianAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-MS2-RecT-dCas9-BSD
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-2XNLS-SpCas9-WT-NLS-3XHA-NLS-TALentry
Plasmid#69232PurposeWild type SpCas9 expression plasmid to clone TALEs through BbsI site (generates compatible overhangs with Acc65I and BamHI sites)DepositorInsertSpCas9
UseCRISPRTags2X NLS, BbsI TALE entry cassette, and NLS-3XHA-NL…ExpressionMammalianAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dFnCas9
Plasmid#201954PurposeMammalian expression plasmid of dead FnCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dFnCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD11A and H969A on FnCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
Tags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIW601-KmCRISPR
Plasmid#98907PurposeK. marxianus CRISPR Plasmid for sgRNA cloningDepositorInsertsCodon optimized Cas9
sgRNA expression cassette
UseCRISPR and Synthetic BiologyTagsSV40ExpressionYeastAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-GFP (PX458)
Plasmid#129025Purposetargeted DNA demethylation, expression of dCas9-huTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-huTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only