We narrowed to 14,499 results for: SHR;
-
Plasmid#88847PurposeCRISPR KO of Trp53DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only
-
PRKCB gRNA (BRDN0001148507)
Plasmid#75954Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAR1A gRNA (BRDN0001146329)
Plasmid#77720Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAR1A gRNA (BRDN0001144984)
Plasmid#77721Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAR1A gRNA (BRDN0001146809)
Plasmid#77722Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAR1ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABE7.10-F148A
Plasmid#132946PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertABE7.10(F148A)
UseCRISPR; Base editorExpressionMammalianMutationABE7.10(F148A)Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgKEAP1-2
Plasmid#186459Purposeknock out KEAP1 in mammalian cellsDepositorInsertKeap1 (Kelch-like ECH-associated protein 1) (KEAP1 Human)
UseCRISPR and LentiviralAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_070
Plasmid#164265PurposeLentiviral vector that enables Cre-mediated sgRNA expression. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsgRNA cassette
UseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterHuman U6Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgR26
Plasmid#127376PurposeUsed for contransfection with pR26- and pR26-CMVconst-derived constructs to mediate CRISPR/Cas9 genomic insertion into the murine ROSA26 safe harbor locus.DepositorInsertROSA26 (Gt(ROSA)26Sor Mouse)
UseCRISPR and Mouse TargetingAvailable SinceFeb. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-sgNeuN-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128346PurposepAAV encoding control gRNA for CRISPR gRNAs listed aboveDepositorAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
PTK2 gRNA (BRDN0001146703)
Plasmid#75544Purpose3rd generation lentiviral gRNA plasmid targeting human PTK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna3-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128338PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEB1N-LZ-LOV2(wt)
Plasmid#107614PurposeN-terminal half of π-EB1 with wild-type LOV2, no fluorescent tagDepositorInsertMAPRE1 (MAPRE1 Human)
TagsA. sativa phototropin 1 LOV2 domain and GCN4 leuc…ExpressionMammalianMutationEB1 aa 1-185; resistant to EB1 shRNA#3 (Addgene #…PromoterCMVAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 sgKEAP1-3
Plasmid#186837Purposeknock out KEAP1 in mammalian cellsDepositorInsertKeap1 (Kelch-like ECH-associated protein 1) (KEAP1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
mAID-BRD4 donor
Plasmid#140650PurposeBRD4 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-COSMC-KO
Plasmid#80008PurposegRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans.DepositorInsertCOSMC (C1GALT1C1 Human)
UseCRISPRAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA non target
Plasmid#223698PurposegRNA control for dPspCas13b-FTODepositorInsertgRNA target sequence for luciferase control
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only