We narrowed to 2,485 results for: 683
-
Plasmid#76309Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_ABCB9_WT
Plasmid#82899PurposeGateway Donor vector containing ABCB9, part of the Target Accelerator Plasmid Collection.DepositorInsertABCB9 (ABCB9 Human)
UseGateway entry vectorMutation582_590delISLVSQEPVinsVCARAWATL; 592_595delFARSin…PromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
IMPT-10917
Plasmid#236192PurposeExpress GPR6 in insect cellsDepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-Lbr-V5-mCherry
Plasmid#235093PurposeLbr mCherry fusion protein with MCP domainDepositorAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-S27A Neo
Plasmid#223059PurposeMETTL1-S27A gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdest METTL1-S27D Neo
Plasmid#223060PurposeMETTL1-S27D gene expression in mammalian cellsDepositorAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:METTL1-S27A_CE_pISceI
Plasmid#223048PurposeExpress METTL1-S27A gene in mesenchymal lineage of Zebrafish.DepositorInsertMETTL1-S27A (METTL1 Human)
UseExpress the insert(gene) in mesenchymal lineage o…MutationS27APromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:METTL1-S27D_CE_pISceI
Plasmid#223049PurposeExpress METTL1-S27D gene in mesenchymal lineage of Zebrafish.DepositorInsertMETTL1-S27D (METTL1 Human)
UseExpress the insert(gene) in mesenchymal lineage o…MutationS27DPromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:METTL1-CM_CE_pISceI
Plasmid#223050PurposeExpress METTL1-CM gene in mesenchymal lineage of Zebrafish.DepositorInsertMETTL1-CM (METTL1 Human)
UseExpress the insert(gene) in mesenchymal lineage o…Mutation160-163 (LFPD>AFPA)PromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC[∆2-83]-His+MFN2-Strep (SB259)
Plasmid#227608PurposeInducible coexpression of His-tagged SLC25A46 in its N-terminal region (∆2-83) and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastMutationaa 2-83 deletedPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2-Strep (SB255)
Plasmid#227604PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook2_FTS_FHIP2A
Plasmid#222302PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK2 and FHIP2A) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionInsectAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-Lgi1 [N283/7R-2b]
Plasmid#222172PurposeMammalian Expression Plasmid of anti-Lgi1 (Mouse). Derived from hybridoma N283/7.DepositorInsertAnti-Lgi1 (Mus musculus) recombinant mouse monoclonal antibody. (Lgi1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_2
Plasmid#195135PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 2 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Upstream_gRNA_1
Plasmid#195134PurposegRNA in a third generation Cas9 vector with GFP, targeting region immediately upstream of MDM4, to be used with MDM4_Deletion_Downstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Upstream gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3a- pMK293 (mAID-mCherry2-Hygro) plasmid
Plasmid#192236Purposeknockin donor vector of mAID-mCherry2-Hygro to C-terminus of endogenous human eIF3aDepositorInserteIF3a-knockin-homology arm-mAID-mCherry2-Hygro (EIF3A Human)
ExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
eIF3a- pMK289 (mAID-mClover-NeoR) plasmid
Plasmid#192235Purposeknockin donor vector of mAID-mClover-NeoR to C-terminus of endogenous human eIF3aDepositorInserteIF3a-knockin-homology arm-mAID-mClover-NeoR (EIF3A Human)
ExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-KLRC1-Fc(DAPA)-AviTag-6xHis
Plasmid#156532PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertKLRC1 (KLRC1 Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-KCNT2/Slo2.1/Slick K+ channel [N11/33R]
Plasmid#114496PurposeMammalian Expression Plasmid of anti-KCNT2/Slo2.1/Slick K+ channel (Mouse). Derived from hybridoma N11/33.DepositorInsertanti-KCNT2/Slo2.1/Slick K+ channel (Mus musculus) recombinant mouse monoclonal antibody (Kcnt2 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GALNTL5_p.D221E
Plasmid#81563PurposeGateway Donor vector containing GALNTL5 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ABCB9_p.R281L
Plasmid#82840PurposeGateway Donor vector containing ABCB9, part of the Target Accelerator Plasmid Collection.DepositorInsertABCB9 (ABCB9 Human)
UseGateway entry vectorMutationR281RL; 582_590delISLVSQEPVinsVCARAWATL; 592_595d…PromoterNoneAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GALNTL5_p.G309E
Plasmid#81449PurposeGateway Donor vector containing GALNTL5 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001149267)
Plasmid#76312Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-H2B-iRFP670-p2a-mCerulean-Geminin (1–110)-IRES-Neomycin
Plasmid#223959PurposeDual fluorescent reporter for histone H2B and for APC/C activityDepositorUseLentiviralTagsiRFP670 and mCeruleanExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-hGeminin
Plasmid#199344Purposemodified version of the eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA plasmid (addgene #86613) where the C-terminus of the eSpCas9 enzyme was fused to amino acids 1 – 110 of human GemininDepositorInsertATP1A1 G3 sgRNA+user-specified sgRNA+enhanced specificity Cas9 (1.1) (addgene 86613) with cas9 fused to hgem fragment 1-110) (GMNN S. pyogenes)
Tagscas9 c-term fused to hgemenin 1-110 fragmentExpressionMammalianMutationcas9 c-term fused to hgemenin 1-110 fragmentPromotercbhAvailable SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-GFP
Plasmid#66083PurposeG protein alpha-s internally tagged with EGFP and EE epitopeDepositorInsertG-alpha-s-EE-EGFP (Gnas Rat)
TagsEGFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PRDX5WT-VA
Plasmid#98688PurposeLentiviral expression of human PRDX5-WT in mammalian cellsDepositorAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PTK9
Plasmid#23651DepositorInsertPTK9 (TWF1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_CUX1_NUTM1
Plasmid#205800PurposeExpress mEGFP-tagged fusion protein, CUX1_NUTM1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-CFP
Plasmid#55793PurposeG protein alpha-s internally tagged with ECFP and EE epitopeDepositorInsertG-alpha-s-EE-ECFP (Gnas Rat)
TagsECFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationHis was substituted for Asn164 in ECFP (Clontech)…PromoterCMVAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-TEAD4-YBD
Plasmid#166450PurposeExpresses fusion of mCherry and TEAD4-YAP binding domainDepositorAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCherry
Plasmid#66968PurposeG protein alpha-s internally tagged with mCherry and EE epitopeDepositorInsertG-alpha-s-EE-mCherry (Gnas Discosoma sp., Rat)
Tagsinternal EE epitope (residues 189-194 in alpha- s…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PINK1
Plasmid#23504DepositorInsertPINK1 (PINK1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
Anti-Celf4/Brunol4 [N446/80R]
Plasmid#206584PurposeMammalian Expression Plasmid of anti-Celf4/Brunol4 (Human). Derived from hybridoma N446/80.DepositorInsertanti-Celf4/Brunol4 (Homo sapiens) recombinant Mouse monoclonal antibody (CELF4 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only