We narrowed to 5,008 results for: AAT
-
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ERBB3-v1
Plasmid#154893PurposeExpresses ERBB3 (a.k.a HER3) fused to Venus fragment 1 (v1) for use in bimolecular fluorescence complementation (BiFC) assaysDepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaMyosin binding domain
Plasmid#187275PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Myosin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaMyosin binding domainPromoterU6, CMVAvailable SinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-SNCA-A53T
Plasmid#181738PurposeTransiently expressing a pegRNA to introduce SNCA-A53T mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A53T (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBPK1520-SNCA-A53T-ng
Plasmid#181739PurposeTransiently expressing a nicking sgRNA to facilitate the introduction of SNCA-A53T mutation in PE3 approachDepositorInsertPrime editing ngRNA for SNCA-A53T (SNCA Human)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF2521
Plasmid#142319PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC1A6_STOP
Plasmid#161152PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A6 (SLC1A6 Human)
ExpressionMammalianAvailable SinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU6-pegRNA-SNCA-A30P
Plasmid#180016PurposeTransiently expressing a pegRNA to introduce SNCA-A30P mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A30P (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AURKA gRNA (BRDN0001148015)
Plasmid#77726Purpose3rd generation lentiviral gRNA plasmid targeting human AURKADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ILK gRNA (BRDN0001147357)
Plasmid#75909Purpose3rd generation lentiviral gRNA plasmid targeting human ILKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
KDR gRNA (BRDN0001146648)
Plasmid#77756Purpose3rd generation lentiviral gRNA plasmid targeting human KDRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK3 gRNA (BRDN0001145321)
Plasmid#75546Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTK gRNA (BRDN0001147779)
Plasmid#75581Purpose3rd generation lentiviral gRNA plasmid targeting human TTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HCK gRNA (BRDN0001147690)
Plasmid#77213Purpose3rd generation lentiviral gRNA plasmid targeting human HCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR IMMP2L sg2
Plasmid#244852PurposeKnockout of human IMMP2LDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_ZCRB1 (pAVA3300)
Plasmid#239325PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNA stargeting ZCRB1DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting ZCRB1 (ZCRB1 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only