We narrowed to 10,976 results for: esp
-
Plasmid#34178DepositorInsertCG8361 (E(spl)m7-HLH Fly)
UseGateway CloningAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-s ONE-GO
Plasmid#189731PurposeGPCR/G protein BRET biosensorDepositorInsertsUseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-5HRE-GFP PuroR
Plasmid#128958PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
YY171: pPB_NFκB::GFP-GEMINI(A)_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228883PurposePiggyBac plasmid expressing the GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
JL054: pPB_NFκB::GFP-GEMINI(A)-P1N4_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228884PurposePiggyBac plasmid expressing the destabilized GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ARR3tk-eGFP/SV40-mCherry
Plasmid#132360PurposeTo measure transcriptional activity of Androgen ReceptorDepositorInsertAR responsive elements (AR Human)
UseLentiviralAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFRT-FLAG-HA-(N)-CDK12
Plasmid#231750PurposeExpression in Flp-IN human cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP NeoR
Plasmid#128960PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hHS1-M7A,H102A
Plasmid#159171PurposeHuman codon-optimized cytosolic labile heme reporterDepositorInserthHS1-M7A,H102A
ExpressionMammalianMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
Luciferase
Plasmid#213979PurposeExpresses Doxy Inducible LuciferaseDepositorInsertLuciferase
UseLentiviralTags6xHis affinity tagExpressionBacterial and MammalianPromoterTet-responsive promoter PTight, consisting of sev…Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pEND-351_Cacnes_dCas9_CRISPRi
Plasmid#225617PurposeCutibacterium acnes replicative plasmid with dCas9 for CRISPRi. pBRESP36A-based vector optimized for reduced size and modular assembly, harbouring a medium-copy pBR322 E. coli ori (no ROP)DepositorInsertdCas9
UseCRISPR and Synthetic BiologyTags6xHisExpressionBacterialMutationCodon optimized for Cutibacterium acnesAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-SFFV-rtTA3-IRES-Luc-P2A-mtagBFP
Plasmid#176027Purposeconstruct expresses the reverse tet-responsive transactivator 3 (rtTA3) together with Luciferase (Luc) for bioluminescence in vivo imaging, and mTaqBFP for enriching transgenic cells by flow cytometryDepositorInsertsrtTA3
Luc2
mtagBFP
UseLentiviralAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
Str-STIM1-NN_puromycin
Plasmid#65310PurposeLuminal ER hook only (RUSH system)DepositorInsertSTIM1 mutated for binding motif to microtubule (STIM1 Human)
TagsstreptavidinExpressionMammalianMutation2 amino acids of STIM1 (IP from SxIP motif) were …PromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO (pEHA1339)
Plasmid#209088PurposeBackbone plasmid for Tet Responsive transgene expression, FRT integrationDepositorTypeEmpty backboneExpressionMammalianAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Progerin
Plasmid#69061Purposeencodes the lamin A mutant with a 50 amino acids deletion responsible for the Hutchinson-Gilford Progeria SyndromeDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDYT001
Plasmid#186549PurposeLineage tracing vector (with barcoded Target Sites and triple sgRNAs)DepositorInsert14-bp random integration barcode and three target sites and 3x sgRNAs
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGF1-4eCOL2A1
Plasmid#97210PurposeLentiviral expression of copGFP-T2A-FLuc under control of a COL2A1-based, chondrogenesis-responsive promoterDepositorInsert4 repeats of COL2A1 intronic enhancer (+2126/+2174) upstream of core promoter (-164/+37) (COL2A1 Human)
UseLentiviral and LuciferaseExpressionMammalianPromoterCOL2A1 regulatory elementsAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only