We narrowed to 18,353 results for: multi
-
Plasmid#201185PurposeProtein expression plasmid for recombinant His-Myc tag mouse PLD4DepositorTagsHis-Myc, Factor Xa cleavableExpressionMammalianMutationcytosolic and transmembrane domain truncated; add…PromoterCMVAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV_CaMKIIa(0.4)-PdCO-EGFP-WPRE
Plasmid#198514PurposeExpresses optimized PdCO in frame with EGFP under control of minimal CamKIIa promotor.DepositorInsertPdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterCaMKIIα minimal promotor (0.4kb)Available sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK)
Plasmid#172328PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato 2a HSVtk 2a Neo followed by an PGK promoter driving nuclear d2eGFP E2A HygromycinDepositorPublicationInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterPGKAvailable sinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA-CRY2-mCh-superPLDx30-P2A-CIBN-CAAX
Plasmid#188992PurposeA plasmid for dual expression of CRY2-mCh-superPLDx30 (an engineered PLD mutant with 30 times higher activity than the wild-type) and plasma membrane-tagged CIBNDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPLD
TagsCAAX, CIBN, CRY2, P2A, and mCherryExpressionMammalianMutationK109R, P245A, G328S, G381V, G429DPromoterCMVAvailable sinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV15_pCAG.Cas9.gRNA.S1
Plasmid#199259PurposeExpression construct encoding SpCas9 nuclease and an AAVS1-targeting guide RNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsSpCas9 nuclease
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available sinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-sfCherry2_SEPT6
Plasmid#180313Purposebacterial co-expression of human SEPT2 fused to superfolder Cherry2 and of human SEPT6DepositorTagsHis6-TEV and sfCherry2ExpressionBacterialAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
NLS-tdPCP-GFP-VPR
Plasmid#183936PurposePCP tandem dimer binding to PP7 RNA stem loops coupled to VP16 activation domain; labeled with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttdPCP-GFP-VPR
TagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH1
Plasmid#164800PurposeFor CRISPRi knockdown of ERH by lentiviral delivery of ERH gRNA1DepositorInsertsERH CRISPRi gRNA1
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF1Alpha and U6Available sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.ERH2
Plasmid#164801PurposeFor CRISPRi knockdown of ERH by lentiviral delivery of ERH gRNA2DepositorInsertsERH CRISPRi gRNA2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterEF1Alpha and U6Available sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-PLXNB2-mGAP
Plasmid#86241PurposeLentivirus for expression of human Plexin-B2 with mutant GAP domainDepositorInsertPlexin-B2 (PLXNB2 Human)
UseLentiviralExpressionMammalianMutationPLXNB2 with point mutations of GAP domainPromoterhPGKAvailable sinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKF-D2irTNP2AG-T2APuroR-5kwh
Plasmid#128255PurposeMammalian linearizer gene circuit based on negative feedback in a Flp-In expression system controlling the PuroR gene.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthTetR::P2A::EGFP::T2A::PuroR
UseSynthetic Biology; Flp-in expression vectorExpressionMammalianPromoterCMV-D2ir promoterAvailable sinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFGL1079
Plasmid#116897PurposeCenpC:eGFP (centromere marker)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCenp C (partial)
eGFP
CenpC downstream region
UseFungal expression (in magnaporthe oryzae)Mutationtruncated, no stop codon and without start codonAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
Plasmid#111388PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)DepositorAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-Q927P4
Plasmid#103131PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertQ927P4(Cas9 coding gene from Listeria innocua serovar 6a (strain CLIP 11262))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A0LWB3
Plasmid#103070PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertA0LWB3(Cas9 coding gene from Acidothermus cellulolyticus (strain ATCC 43068 / 11B))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-RORb2-IRES-GFPd2
Plasmid#73998PurposePlasmid expressing RORb2-IRES-GFPd2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRORb2 ORF (Rorb Mouse)
TagsnoneExpressionMammalianPromoterCAGAvailable sinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-MKOS
Plasmid#80484PurposepiggyBac transposon for dox-inducible expression of the MKOS polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE(K294A) NLS-Flag
Plasmid#82469PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzyme, inactive formDepositorInsertmRNA capping enzyme (Rngtt Mouse)
TagsFlag and MycExpressionMammalianMutationchanged Lysine 294 to AlaninePromoterCMVAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-myc NES-mCE NLS-Flag
Plasmid#82468PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal flag tagged mRNA capping enzymeDepositorAvailable sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only