We narrowed to 18,123 results for: multi
-
Plasmid#170808PurposePiggyBac vector to express GA-inducible VPR-Sa_dCas9 with hygromycin resistanceDepositorInsertsExpressionMammalianMutationSynonymous mutation in PYL1 to remove XhoI site (…Available SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_hsHAUScomplex_FL
Plasmid#202203PurposeBaculoviral transfer vector to co-express 8 subunits of human augmin complexDepositorInsertsHAUS1 (HAUS1 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS3 (HAUS3 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS2 (HAUS2 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS6 (HAUS6 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS7 (HAUS7 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS4 (HAUS4 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS5 (HAUS5 codon-optimized form for expression in Trichoplusia ni cells, Human)
HAUS8 (HAUS8 codon-optimized form for expression in Trichoplusia ni cells, Human)
Tags-mGFP-TEV-TwinStrep and His-tag (6x)ExpressionInsectPromoterpolyhedrin promoterAvailable SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRI001-pGEM-LS-Bar-PgpdA-dLbCas12a-VPR-Ttrpc-LS
Plasmid#140193PurposeChromosomal integration of PgpdA-dLbCas12a-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi integrative vector.DepositorInsertsdLbCas12a-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNAse deactivatedPromoterPgpdA and PtrpCAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2 ZfUbi::cMyc-oDam_f_GFPoNLS
Plasmid#85821PurposeiDamID plasmid. To stably and ubiquitously express the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertZf Ubi::cMyc oDam_f_GFPoNLS
UseTol2 based vectorTagscMyc N terminal to oDam_f_GFPoNLS and oNLS (optim…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-7 in pcDNAI/Amp
Plasmid#54473PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-7. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-7 (GNG7 Aequorea victoria, Human)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTH744-CEN-RLuc/slowmaxCFLuc
Plasmid#38224DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Antibody#180088-rAbPurposeAnti-RGS14 (Rat) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityMouse and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLPB3B-mAID-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin-T2A-osTIR1
Plasmid#187963PurposemAID degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance, T2A site and osTIR1 under PGK promoter.DepositorInsertsAID-SpdCas9-tagRFPt-P2A-tagBFP; Blasticidin-T2A-osTIR1
osTIR1
UseCRISPR and Synthetic BiologyTagsGGS linker and T2AExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-1 in pcDNAI/Amp
Plasmid#55592PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-1. When co-expressed with an amino-trerminal CFP or YFP fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCFP (159-238)-Beta 1 (GNB1 Aequorea victoria, Human)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A05.T)
Viral Prep#157970-AAV.A05.TPurposeReady-to-use AAV2 (Y444F) in BSS particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTR-UF11 (AAV.A04.T)
Viral Prep#157970-AAV.A04.TPurposeReady-to-use AAV2 (Y444F) in TMN200 particles produced from pTR-UF11 (#157970). In addition to the viral particles, you will also receive purified pTR-UF11 plasmid DNA. 'Humanized' GFP driven by Chimeric CMV/Chicken Beta Actin promoterDepositorPromoterchimeric CMV/Chicken Beta actin (CBA)TagsGFPAvailable SinceDec. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
Plasmid#246432PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain (ADARB1 Synthetic, Human, human gut metagenome)
mCherry
ωRNA
TagsHIV NES, SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker …ExpressionMammalianMutationR-IscB: changed Aspartic Acid 60 to Alanine, chan…PromoterCMV and U6Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
Antibody#192041-rAbPurposeAnti-NSD1 (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistryReactivityHumanSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Antibody#184180-rAbPurposeAnti-6xHis recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistry and Western BlotReactivitySyntheticSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceSept. 2, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#180092-rAbPurposeAnti-HCN1 (Rat) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunohistochemistry and Western BlotReactivityHuman, Mouse, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits