We narrowed to 11,822 results for: nts
-
Plasmid#195303PurposepBAD322-MycaIDCas-ΔCas6-RGR-PaqCI, arapBAD promoter expressing type I-D Cascade of McCAST (Tn7575) without cas6 gene and ribozyme flanked PaqCI entry site.DepositorInsertMcCAST Cascade Δcas6 and ribozyme flanked entry site
ExpressionBacterialPromoterArabinose inducible arapBADAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPO812
Plasmid#195306PurposepBAD322-MycaIDCas-ΔCas6-RGR-lacZs, arapBAD promoter expressing type I-D Cascade of McCAST (Tn7575) without cas6 gene and ribozyme flanked lacZ spacer 5.DepositorInsertMcCAST Cascade Δcas6 and ribozyme flanked lacZ spacer 5
ExpressionBacterialPromoterArabinose inducible arapBADAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1-14-GFP11
Plasmid#180344Purposemammalian expression of human SEPT9_i1 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP10
Plasmid#180345Purposemammalian expression of human SEPT9_i3 fused to GFP10DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP11
Plasmid#180346Purposemammalian expression of human SEPT9_i3 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODALvar-matMYC
Plasmid#115641PurposeFor targeted integration and inducible expression of a human NODAL splice variant (with an N-terminal MYC tag on the mature peptide) using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-matMYC-C312S
Plasmid#115256PurposeFor mammalian expression of the human NODAL open reading frame (with a mutated Cysteine residue) with an internal MYC tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-matDYK-C312S
Plasmid#115259PurposeFor mammalian expression of the human NODAL open reading frame (with a mutated Cysteine residue) with an internal DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-N72A-N199A
Plasmid#115264PurposeFor in vitro transcription of human NODAL open reading frame (with two mutated N-glycosylation sites) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-matMYC
Plasmid#115249PurposeFor mammalian expression of a human NODAL splice variant open reading frame with an internal MYC tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-hRPH3A_c.444Tmut
Plasmid#190477Purposeminigene assayDepositorInsertRPH3A (NM_014954.3) c.1853 [exon 20 and part of surrounding introns only] (RPH3A Human)
ExpressionMammalianMutationc.444G>TPromoterSV40Available SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-hRPH3A_c.1853Awt
Plasmid#190478Purposeminigene assayDepositorInsertRPH3A (NM_014954.3) c.1853 [exon 20 and part of surrounding introns only] (RPH3A Human)
ExpressionMammalianPromoterSV40Available SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-C.37-AVI
Plasmid#181702PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-C.37-AVI
Plasmid#181696PurposeExpresses SARS-CoV-2 NTD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG75V, T76I, R246N, ∆S247-∆D253,Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only