We narrowed to 20,048 results for: ARIA
-
Plasmid#86972PurposeExpresses PCNA3 variant (R112C/T180C) fused phosphite dehydrogenase and P450cam in E. coliDepositorInsertPCNA3 variant (R112C/T180C) fused to phosphite dehydrogenase and P450cam
TagsHis6 tagExpressionBacterialMutationE175A/A176R in PTDH, N106R/R112C/T180C in PCNA3, …PromoterT7 promoterAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
p1G108CFa
Plasmid#85089PurposeExpresses PCNA1 variant (G108C) fused to an FAD domain of P450 BM3 (A74G/C773S/C810S) in E. coliDepositorInsertThe G108C variant of PCNA1 fused to an FAD domain of P450 BM3
TagsHis6 tagExpressionBacterialMutationG108C in PCNA1, A74G/C773S/C810S in FAD domain of…PromoterT7 promoterAvailable SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRevLCav2deltaC
Plasmid#60809Purposeto make truncation of yeast Rev3DepositorInsertREV3 (REV3 Budding Yeast)
ExpressionYeastMutationrev3ΔC encodes for Rev3 lacking the C-terminus (a…Available SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR4-*mRFP
Plasmid#47118PurposeCan be used to make an RNA probe for whole-mount in situ hybridization, for in-frame fusion proteins or as a subcloning step for mRFP. Note that the coding sequence for mRFP lacks the start codon.DepositorInsert*mRFP
ExpressionBacterialMutationNo start codonPromoterLacAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 L306P
Plasmid#169262PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 L306PDepositorInsertNop4 L306P (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationp.(Leu306Pro)PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE5
Plasmid#169263PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 5DepositorInsertNop4 delta E5 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE8
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 L351P
Plasmid#169266PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 L351PDepositorAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE5
Plasmid#169267PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 5DepositorInsertRBM28 delta E5 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-RBM28 dE8
Plasmid#169268PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-RBM28 delta Exon 8DepositorInsertRBM28 delta E8 (RBM28 Human)
Tags3xFLAGExpressionYeastMutationdeleted Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 E5 GT>A minigene
Plasmid#169270PurposeMammalian vector for constitutive expression of RBM28 Exon 5 GT>A minigeneDepositorInsertRBM28 E5 GT>A minigene (RBM28 Human)
ExpressionMammalianMutationNM_018077.2:c.(541+1_541+2delinsA)PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 E8 G>T minigene
Plasmid#169272PurposeMammalian vector for constitutive expression of RBM28 Exon 8 G>T minigeneDepositorInsertRBM28 E8 G>T minigene (RBM28 Human)
ExpressionMammalianMutationNM_018077.2:c.(946G>T)PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 WT minigene
Plasmid#169273PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 WT minigeneDepositorAvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO - RBM28 Exon1-6 E5 GT>A minigene
Plasmid#169274PurposeMammalian vector for constitutive expression of RBM28 Exon 1-6 GT>A minigeneDepositorInsertRBM28 Exon1-6 GT>A minigene (RBM28 Human)
ExpressionMammalianMutationNM_018077.2:c.(541+1_541+2delinsA)PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pLV-hTERT-IRES-hygro
Plasmid#85140PurposeLentiviral expression of hTERT, used to create immortalized cell linesDepositorAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6/sgClta-sfGFP-Clta
Plasmid#200261PurposeU6 promoter expressing sgClta. Clta homology arms, sfGFP knock-in.DepositorInsertsfGFP flanked by homology arms targeting Clta, additional U6 promoter expressing sgClta
UseAAVAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-PTRE-tight-hM3Dq-mCherry
Plasmid#66795PurposeExpresses the DREADD receptor hM3Dq-mCherry under the control of tet-inducible promoter for use in TetTagingDepositorInsertpTIGHT promoter-hM3Dq-mCherry
UseAAVExpressionMammalianPromoterpTIGHT TREAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Humanized Hinge Notch SNIPR (HNF1A)
Plasmid#188384PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a CD8alpha-variant2-ECD, a Notch1-TMD, a Notch2-JMD, and a HNF1A(DBD)-p65(361-551) transcriptional factorDepositorInsertPGK_antiCD19_CD8alpha-variant2-ECD_Notch1-TMD_Notch2-JMD_HNF1A(DBD)-p65(361-551)
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Humanized Hinge Notch SNIPR (Pax6)
Plasmid#188383PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a CD8alpha-variant2-ECD, a Notch1-TMD, a Notch2-JMD, and a Pax6(DBD)-p65(428-551) transcriptional factorDepositorInsertPGK_antiCD19_CD8alpha-variant2-ECD_Notch1-TMD_Notch2-JMD_Pax6(DBD)-p65(428-551)
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only