We narrowed to 16,424 results for: grn
-
Plasmid#160608PurposeTU for the expression of the dCas9 with the repressor domain SRDX as a CT fusion (CRISPR tools)DepositorInsertP35s:dCas9:SRDX:tNOS
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
POLR2A-N CRISPR pX330
Plasmid#124495PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2ADepositorInsertPOLR2A targeting CRISPR
UseCRISPRPromoterU6 promoterAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #4-Blast
Plasmid#199647PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-deSpCas9
Plasmid#92114PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity eSpCas9 (1.1) (without U6-sgRNA coding sequence)DepositorInsertdead/inactive eSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840A, K848A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE CACNG8-GFP KI #2
Plasmid#131474PurposeEndogenous tagging of Tarpγ8: Intramolecular (amino acid position: A408)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAT105
Plasmid#180510PurposePlasmid expressing mammalian codon optimized engineered DpbCasX-R3, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
DpbCasX with R3 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDicAID_nCas9-PmCDA-2A-NptII_ETR
Plasmid#91695PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1-2A-NptII with sgRNA targeting SlEtrDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-Lambda2
Plasmid#104184PurposeLentiviral transfer vector that carries U6-driven non-targeting sgRNA using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-sgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mMyh9 - 2
Plasmid#198492Purposelentiviral stable expression of mMyh9 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mMyh9 - 1
Plasmid#198491Purposelentiviral stable expression of mMyh9 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank1-GFP KI
Plasmid#131500PurposeEndogenous tagging of Shank1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-BaeI-Pgk-Cre
Plasmid#173663PurposeVector with BaeI site to allow cloning of custom sgRNA into vector containing Cre-recombinaseDepositorInsertBaeI site
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgVRK1 #1-Blast
Plasmid#199646PurposeExpresses Cas9 and sgRNA guide targeting VRK1DepositorInsertN/A (VRK1 Human)
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Nanog_2
Plasmid#174871PurposeCRISPR vector for generating Nanog STREAMING-tag KI cellDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Shank2-GFP KI
Plasmid#131496PurposeEndogenous tagging of Shank2: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-Universal.Sth.dCas9
Plasmid#171088PurposeCRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.DepositorInsertsToxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
DHFR-TSc3
UseToxoplasma gondii expressionMutationNote: A S245F mutation is present but did not app…PromoterDHFR-TS (Toxoplasma gondii) and U6 (Toxoplasma go…Available SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD
Plasmid#196086PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting lncRNA NORAD.DepositorInsertgRNA targeting lncRNA NORAD
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
P789_pY026_EnAsCpf1_CLYBL_T1_catRNA
Plasmid#202760PurposeEncodes for CRISPR-Cas12a (EnAsCpf1) with gRNA for targeting the CLYBL safe harbor siteDepositorInserthuAsCpf1
ExpressionMammalianPromoterCMVAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Doc2A-GFP KI
Plasmid#131478PurposeEndogenous tagging of Doc2a: C-terminal (amino acid position: L402)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only