We narrowed to 13,850 results for: sequence
-
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Antibody#194502-rAbPurposeAnti-DYKDDDDK recombinant mouse monoclonal antibody; binds to FLAG tag sequence.DepositorRecommended ApplicationsWestern BlotReactivitySyntheticSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceFeb. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#182223-rAbPurposeAnti-Cav1.2/1.3 Ca2+ channel (Rabbit) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsImmunocytochemistry and Western BlotReactivityMouse, Rabbit, and RatSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceJune 13, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#198003-rAbPurposeAnti-HA chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a rabbit IgG Fc.DepositorRecommended ApplicationsWestern BlotSource SpeciesRabbitIsotypeIgGTrial SizeAvailable to purchaseAvailable SinceMarch 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#199805-rAbPurposeAnti-HA chimeric recombinant antibody. The hybridoma-derived heavy chain variable sequence and kappa light chain are fused to a chicken IgY Fc.DepositorRecommended ApplicationsWestern BlotSource SpeciesChickenIsotypeIgYTrial SizeAvailable to purchaseAvailable SinceApril 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
SUPERBLADE5
Plasmid#134913PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades system (Optimized for increased genome editing efficiency via Chen B et al., 2013)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-FRCaMPi
Plasmid#232838PurposeAAV transfer plasmid for Syn-mediated expression of FRCaMPiDepositorInsertNES-SomaFRCaMPi
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterSynAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-pur-CAG-Bi-DREADD
Plasmid#159457PurposeAAVS1 targeting donor plasmid with Bi-DREADD expression cassette (hM3Dq-mCherry-P2A-HA-KORD) and puromycin selection geneDepositorInsertBi-DREADD
ExpressionMammalianMutationfusion protein of hM3Dq-mCherry and HA-KORD seper…PromoterCAGAvailable SinceDec. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-mCherry-P2A-HA-KORD
Plasmid#204359PurposeAAV vector for coexpression of miniDq and KORD under the control of human synapsin promoterDepositorInsertminiDq-mCherry-P2A-HA-KORD
UseAAVTagsHA (for KORD) and mCherry (for miniDq)MutationFor miniDq, the third intracellular loop (ICL3) o…PromoterhSynAvailable SinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC7A11
Plasmid#132244PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC7A11 (SLC7A11 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEGFP-TDP-43 (NLSmut)
Plasmid#235489PurposeExpression of human TDP-43-EGFP with mutated nuclear localization sequenceDepositorInsertTARDBP (TARDBP Human)
TagsEGFPExpressionMammalianMutationK82A, R83A, K84A, K95A, K97A, R98AAvailable SinceMay 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-CMV-SOD2-2A-Catalase-WPRE
Plasmid#67635PurposeAAV vector expressing both SOD2 and mitochondrial targeted CatalaseDepositorUseAAVMutationDeleted the Peroxisome Targeting Signal from Cata…PromoterCMVAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSynSRE-Mut-T-Luc
Plasmid#60490PurposeContains a mutant version of the WT pSynSRE-T-Luc reporter plasmid. Four point mutations in the promoter SRE elements abolish SREBP-induced luciferase expression as described by Smith et al., 1988DepositorInsertHMG-CoA synthase promoter (-324/-225) fused to HMG-CoA synthase TATAA (-28/+39) transcription initiator sequence
UseLuciferaseTagsLuciferase reporterExpressionMammalianMutationFour point mutations (G->C or A->C) in the …PromoterPartial HMG-CoA synthase promoter (-324/-225) fus…Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 SIRT1-FL
Plasmid#105670PurposeMammalian expression construct of mouse SIRT1 full length isoformDepositorInsertSIRT1 (Sirt1 Mouse)
ExpressionMammalianMutationSynonymous base changes not affecting the protein…PromoterCMVAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC35D3
Plasmid#132110PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC35D3 (SLC35D3 Human)
ExpressionMammalianAvailable SinceNov. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV8R-12 Capsid
Plasmid#213968PurposeAAV packaging vector carrying AAV2 rep gene and Cap8R modified AAV8 capsid coding sequenceDepositorTypeEmpty backboneUseAAVAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only