We narrowed to 16,419 results for: GRN
-
Plasmid#133358PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorInserteSpCas9
TagsFlag-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pORANGE Cplx2-GFP KI
Plasmid#131476PurposeEndogenous tagging of Complexin2: C-terminal (amino acid position: L128)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
HeFSpCas9
Plasmid#92355PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRI018-pKW20088-PelcA-mCherry-TtrpC-PU3-E1-Cas9Scaffold-8xT
Plasmid#140205PurposeProof-of-concept of CRISPR/dSpCas9-VPR activation, encoding PelcA-mCherry along with the sgRNA E1 expression cassette, targeting PelcA.DepositorInsertsmCherry
sgRNA E1
UseCRISPR and Synthetic Biology; Proof-of-concept te…MutationG174DPromoterPelcA and U3Available SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dHeFSpCas9
Plasmid#92116PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive HeFSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterCbhAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(Non-targeting)
Plasmid#109324PurposeAAV vector expressing non-targeting AsCpf1 crRNADepositorInsertmCherry-KASH
UseAAVPromoterhSyn1Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v2-mU6-sgCebpb_v2-hU6-sgCebpd_v2
Plasmid#177258PurposeExpresses Cebpa_v2 (bU6), Cebpb_v2 (mU6), Cebpd_v2 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpb_v2/sgCebpd_v2
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDE722
Plasmid#103022Purposeexpression of a Cpf1 programming crRNA targetting CAN1 (crCAN1-4S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pegAAT K342E correction
Plasmid#169841PurposeExpress a pegRNA used for correction (via A•T-to-G•C) of the E342K mutationDepositorInsertpegAAT K342E correction (SERPINA1 Human)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgPLXNB2
Plasmid#86152PurposeLentivirus carrying Cas9/CRISPR for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE CACNG8-GFP KI #1
Plasmid#131473PurposeEndogenous tagging of Tarpγ8: Intramolecular (amino acid position: V376)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAT526
Plasmid#180513PurposePlasmid expressing mammalian codon optimized wt PlmCasX, mNeonGreen, sgRNAv1 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv1
PlmCasX-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E3B
Plasmid#157783PurposeExpresses a sgRNA targeting the 3rd exon of human FMR1 geneDepositorAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUDE714
Plasmid#103021Purposeexpression of a Cpf1 programming crRNA targetting HIS4 (crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
49535-sgFMR1_E17A
Plasmid#157782PurposeExpresses a sgRNA targeting stop codon of human FMR1 geneDepositorAvailable SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only