We narrowed to 10,946 results for: ESP
-
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-GFP
Plasmid#66083PurposeG protein alpha-s internally tagged with EGFP and EE epitopeDepositorInsertG-alpha-s-EE-EGFP (Gnas Rat)
TagsEGFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLXSN p110 CUX1
Plasmid#90471PurposeRetroviral vector expressing human p110 CUX1 (amino acids 747-1505) with a Myc and HA tag at the N- and C-terminue, respectivelyDepositorInsertCUX1 (amino acids 747-1505) (CUX1 Human)
UseRetroviralTagsHA and MycExpressionMammalianPromoterMoloney murine leukemia virus long terminal repeatAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-CFP
Plasmid#55793PurposeG protein alpha-s internally tagged with ECFP and EE epitopeDepositorInsertG-alpha-s-EE-ECFP (Gnas Rat)
TagsECFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationHis was substituted for Asn164 in ECFP (Clontech)…PromoterCMVAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-K627R_EGFP-PEST_reporter
Plasmid#172597PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-K627R mutant signaling.DepositorInsertmyc-PDGFRA-K627R (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-K627RPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RIα-ICUE4
Plasmid#181848PurposeICUE4 cAMP sensor tethered to the PKA RIα subunit.DepositorTagsECFP, PKA RIα, and cpVenus(L194)ExpressionMammalianMutationGlutamine 122 in Epac1 domain mutated to glutamat…PromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCherry
Plasmid#66968PurposeG protein alpha-s internally tagged with mCherry and EE epitopeDepositorInsertG-alpha-s-EE-mCherry (Gnas Discosoma sp., Rat)
Tagsinternal EE epitope (residues 189-194 in alpha- s…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-DnaJB1-PKAcat(K72H)-mCherry
Plasmid#181851PurposemCherry-tagged DnaJB1-PKA catalytic subunit fusion; contains catalytically dead PKA; for mammalian expression.DepositorTagsmCherryExpressionMammalianMutationLysine 128 in the DnaJB1-PKAcat fusion changed to…PromoterCMVAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLUE-SHLD2
Plasmid#114118PurposeExpresses N-terminally tagged Streptag-HA-CBP-SHLD2 in mammalian cellsDepositorInsertSHLD2 (SHLD2 Human)
TagsHA tag, Streptavidin-binding tag (Streptag), and …ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGV7 (CK2alpha' K69M, CK2beta)
Plasmid#27095DepositorUseTetracycline-regulated expressionTagsHA tag on CK2alpha' and Myc on CK2betaExpressionMammalianMutationK69M on CK2alpha'Promoterbidirectional tet-responsive promoterAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS-TRE-FHDnd1-Ubc-rtTA-I2G
Plasmid#70076Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 in mammalian cellsDepositorInsertDnd1 (Dnd1 Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationSilent mutations are introduced to escape from RN…PromoterTet responsible promoterAvailable SinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-PDGFRA-R914W_EGFP-PEST_reporter
Plasmid#172596PurposeMammalian fluorescent (EGFP-PEST) reporter plasmid for PDGFRA-R914W mutant signaling.DepositorInsertmyc-PDGFRA-R914W (PDGFRA Human, Synthetic)
UseEgfp-pest_reporterTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPDGFRA-R914WPromoterCMVAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS-TRE-FHDnd1-Y102A-Ubc-rtTA-I2G
Plasmid#70075Purpose2nd gen lentiviral vector. tet/dox controllable expression of FLAG-HA-tagged murine Dnd1 (RRM mutant) in mammalian cellsDepositorInsertDnd1 (Dnd1 Mouse)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationY102A. Silent mutations are introduced to escape …PromoterTet responsible promoterAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET3a-SF-LMNC-TS
Plasmid#169374PurposeE. coli expression plasmid for human LMNA residues 31-542, corresponding to the shorter lamin C isoform lacking the unstructured head, with an N-terminal splitFlAsH tag and a C-terminal TwinStrep tag.DepositorInsertLMNA residues 31-542 (LMNA Human)
TagsSplit-FlAsH Tag and TwinStrep TagExpressionBacterialMutationdeleted amino acid 1-30 (unstructured head domain…PromoterNative pET3a promotorAvailable SinceMay 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) CRIP2
Plasmid#107509PurposeExpressing CRIP2, puromycin resistantDepositorInsertCRIP2 (codon optimized) (CRIP2 Human)
UseLentiviralExpressionMammalianMutationCodon optimized sequencePromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCerulean
Plasmid#66084PurposeG protein alpha-s internally tagged with mCerulean and EE epitopeDepositorInsertG-alpha-s-EE-mCerulean (Gnas Aequorea victoria, Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-RXRa-Myc; pGK-H2B-RFP
Plasmid#242887PurposeFor lentiviral overexpression of Myc-tagged human RXRa coupled to H2B-RFP (in the opposite direction)DepositorInsertRxra (RXRA Human)
UseLentiviralTagsH2B-mRFPExpressionMammalianMutationHuman RXRa cDNA was PCR-amplified from pSV-Sport-…PromoterTetracycline response element upstream of a minim…Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only