We narrowed to 26,235 results for: p
-
Plasmid#73454PurposeExpress human N-terminal part (M1-A497) Plekhm1 in mammalian cellsDepositorAvailable SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-FLAG-mTUT6
Plasmid#60043PurposeMammalian expression of FLAG-tagged mouse TUT6DepositorAvailable SinceNov. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PLCE1i1
Plasmid#59628PurposeExpression of shRNA against human PLCE1DepositorAvailable SinceOct. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRb delta CDK + S230
Plasmid#58907Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S230 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S230 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + T252
Plasmid#58910Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and T252 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with T252 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-TMF1i2
Plasmid#59625PurposeExpression of shRNA against human TMF1DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-TMF1i1
Plasmid#59624PurposeExpression of shRNA against human TMF1DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-TTF2i2
Plasmid#59623PurposeExpression of shRNA against human TTF2DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-TTF2i1
Plasmid#59622PurposeExpression of shRNA against human TTF2DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-TTF1i1
Plasmid#59620PurposeExpression of shRNA against human TTF1DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPRKi2
Plasmid#59611PurposeExpression of shRNA against human PTPRKDepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPRKi1
Plasmid#59610PurposeExpression of shRNA against human PTPRKDepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ADAM29i1
Plasmid#59606PurposeExpression of shRNA against human ADAM29DepositorAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer
Plasmid#52878PurposeChloride-conducting Channelrhodopsin with slow kinetics, neuron-specific promoter, plus red fluorescent protein, excitatory neuronsDepositorInsertsChannelrhodopsin-2
red fluorescent protein
UseAAVExpressionMammalianMutationE90R, D156N, T159CPromoterCaMKIIaAvailable SinceJuly 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21a-mAIM2-deltaPYD-GST
Plasmid#51534PurposeExpress GST-tagged HIN domain of mAIM2 in bacteriaDepositorAvailable SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET21a-mAIM2-deltaPYD
Plasmid#51535PurposeExpress His6-tagged HIN domain of mAIM2 in bacteriaDepositorAvailable SinceMarch 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-oChD-citrine
Plasmid#50976PurposeAAV transfer vector with mammalian codon-optimized ChD-citrine between AAV2 ITRDepositorInsertoChD-citrine
UseAAVTagscitrineMutationChD gene is mammalian codon optimizedPromoterhuman synapsin promoterAvailable SinceFeb. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCH044
Plasmid#47950PurposertTA under the control of GAL2 promoterDepositorInsertrtTA
UseTet inducible expressionExpressionYeastPromoterGal2Available SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCH043
Plasmid#47949PurposertTA under the control of GAL1 promoterDepositorInsertrtTA
UseTet inducible expressionExpressionYeastPromoterGal1Available SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only