We narrowed to 1,102 results for: cas12a
-
Plasmid#136549PurposecrRNA backbone for FnCas12a/CmsI nucleases, combine with OsU6-2 promoter module (pFH37)DepositorInsertcrRNA backbone for FnCas12a/CmsI nucleases, combine with OsU6-2 promoter module (pFH37)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH90
Plasmid#128203PurposecrRNA backbone for FnCas12a/CmsI nucleases, combine with TaU3 promoter module (pFH33)DepositorInsertcrRNA backbone for FnCas12a/CmsI nucleases, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH104
Plasmid#128209PurposecrRNA backbone for FnCas12a/CmsI nucleases, combine with AtU6-26 promoter module (pFH35)DepositorInsertcrRNA backbone for FnCas12a/CmsI nucleases, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCas9FnCpf1GG
Plasmid#131013PurposeBackbone plasmid for generating CRISPR arrays for composite array utilized by SpCas9 and FnCas12a using CRATES. Contains a GFP-dropout cassette and two direct repeats.DepositorInsertsdirect repeat of SpCas9
GFP expression cassette
direct repeat of FnCas12a
UseCRISPRExpressionBacterialAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-As
Plasmid#209026PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-Lb
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0014
Plasmid#117550PurposeLevel 1 Golden Gate Cassette: AsCas12a expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + AsCas12a (with stop codon)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L1-dSpRY
Plasmid#177681PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L2-dSpRY
Plasmid#177682PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only