We narrowed to 1,097 results for: cas12a
-
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0014
Plasmid#117550PurposeLevel 1 Golden Gate Cassette: AsCas12a expression cassette for dicotyledonous plantsDepositorInsert2x35S+5'UTR OMEGA (pICH51288) + AsCas12a (with stop codon)+ Nos (pICH41421)
ExpressionPlantPromoter2x35S+5'UTR OMEGA (pICH51288)Available SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L1-dSpRY
Plasmid#177681PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF1-L2-dSpRY
Plasmid#177682PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dCas9-SpRY genome editingDepositorInsertFokI-dCas9-SpRY
UseCRISPR; Gateway compatible foki-dcas9-spry entry …TagsNLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWN10042
Plasmid#89052PurposeGF-ori-FP plasmid for GFxFP assayDepositorInsertsEGFP part 1
EGFP part 2
UseCRISPRExpressionMammalianPromoterCAG and noneAvailable SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-Mb-crRNA
Plasmid#78959PurposeCloning vector for expression of MbCpf1 crRNA. It contains BsmB1 site for cloning.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only