We narrowed to 16,610 results for: grna
-
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPIDAF
Plasmid#213716PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIDAF driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPIBY55
Plasmid#213717PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIBY55 driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPICEAM7
Plasmid#213718PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPICEAM7 driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKJ238
Plasmid#212321PurposeExpress KnFnuc guide with pureexpressDepositorInsertKnFunc guide
ExpressionBacterialAvailable SinceFeb. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSECB sgCASP9
Plasmid#211525PurposeDeletes CASP9DepositorInsertsgCASP9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520 sgFADD
Plasmid#211527PurposeDeletes FADDDepositorInsertsgPIDD
UseCRISPRExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
BPK1520 sgRPS3
Plasmid#211526PurposeFacilitate knock-in of RPS3-Keima fusion proteinDepositorInsertsgRPS3
UseCRISPRExpressionMammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-4
Plasmid#184730PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-1
Plasmid#184735PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-2
Plasmid#184736PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-COX1-4
Plasmid#184722PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-COX2-4
Plasmid#184723PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PTGER2
Plasmid#184724PurposeEP2-KO in MDCKDepositorInsertA gRNA targeting the dog EP2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PLA2G4A_3
Plasmid#184725PurposecPLA2-KO in MDCKDepositorInsertA gRNA targeting the dog cPLA2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-PTGER4
Plasmid#184726PurposeEP4-KO in MDCKDepositorInsertA gRNA targeting the dog EP4 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-3
Plasmid#184727PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-4
Plasmid#184728PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-3
Plasmid#184729PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 sgUCKL1
Plasmid#211523PurposeDeletes UCKL1DepositorInsertsgUCKL1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only