We narrowed to 16,369 results for: gRNA
-
Plasmid#91708PurposeCRISPR/Cas9-mediated base editing in dicots. Contains Cas9(D10A) under CaMV 35S promoter and empty gRNA scaffold, HygRDepositorTypeEmpty backboneExpressionPlantAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pRS316-RGR-GFP
Plasmid#51056PurposeExpress self-cleaving-ribozyme-flanked sgRNA cassette (RGR) targeting GFP for CRISPR systems in yeast driven by ADH1 promoter. RGR has a HH ribozyme at its 5', and an HDV ribozyme at its 3'.DepositorInsertRGR-GFP
UseCRISPRExpressionBacterial and YeastPromoterYeast ADH1 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-scramble
Plasmid#118349PurposeThis plasmid expresses scrabled shRNA for use as a control for shRNA HSFs plasmids.DepositorInsertscrambled shRNA
ExpressionMammalianMutationWTAvailable SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEVA-gRic6T
Plasmid#106401PurposeE.coli-Pseudomonas putida KT2440 shuttle plasmid containing sgRNA targeting the KT2440 genome, and homologous arms.DepositorInsertsgRNA
ExpressionBacterialPromoterpj23119Available SinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro GFP siRNA
Plasmid#12273DepositorInsertGFP siRNA
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTC217
Plasmid#70018PurposeCas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 1bDepositorInsertNuclease (Cas9/sgRNA) + Donor + GVR
UseCRISPRExpressionPlantAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEmCherry2
Plasmid#118413PurposeRed fluorescent reporter for assessing CRISPR gRNA activityDepositorInsertmCherry
UseCRISPRExpressionMammalianAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO-IRES-mScarletI-PGK-Neo
Plasmid#136897PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO.DepositorInsertGFPGO-IRES-mScarletI
UseLentiviralTags3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT05
Plasmid#223377PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUDP004
Plasmid#101165PurposeE. coli/S. cerevisiae shuttle vector carrying amd S marker and Spcas9D147Y P411T allowing cloning of ribozyme flanked g-RNA for Cas9 editing (HH-gRNA-HDV)DepositorTypeEmpty backboneUseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXSE901BG
Plasmid#91714PurposeCRISPR/Cas9-mediated base editing in dicots. Contains Cas9(D10A) under CaMV 35S promoter and empty gRNA scaffold, Basta and glyphosate-resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO2-IRES-mScarletI
Plasmid#136896PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO.DepositorInsertGFPGO2-IRES-mScarletI
UseLentiviralTags2xNLS on GFP, 3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHDE-35S-Cas9-mCherry-UBQ
Plasmid#78932PurposeFor CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants. Enable production of two gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLP16_Lenti Scramble Control
Plasmid#239417PurposeNegative control Lentiviral plasmid for SpCas9-based CRISPR KODepositorInsertScramble sequence
UseLentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-mU6-GFPGO-IRES-mScarletI
Plasmid#136895PurposeLentivirus for base editing activatable GFP expression in mammalian cells. All-in-one vector with sgGO2.DepositorInsertGFPGO-IRES-mScarletI
UseLentiviralTags3xNLS on mScarletMutationATG>ACGPromoterSFFVAvailable SinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ TREX1-KI
Plasmid#127701PurposeFor knocking in TREX1 in mouse - Doxycyclin inducibleDepositorAvailable SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only