We narrowed to 18,006 results for: bon
-
Plasmid#48976Purposefor Cre-lox cassette exchange of untagged gene sequences together with 3 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only
-
TAL-4GA1
Plasmid#41504DepositorInsert4GA1
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRET.IIS.IRES-EGFP
Plasmid#1838DepositorTypeEmpty backboneUseCre/Lox and RetroviralExpressionMammalianAvailable SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
pART7
Plasmid#247985PurposeCloning vector to transiently express an inserted gene in plant cells under the control of the 35S CaMV promoter.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDASH-DIS-α2 (MoClo)
Plasmid#242524PurposeDonor I vector in DASH and alpha2 vector in GoldenBraid/DASH, with SacB counter-selection, compatible with MoClo, with attBTT and attBCC-FRTDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3387_KanR_4p
Plasmid#247310PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3387 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPLacUV5Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB06_3360_6p
Plasmid#247311PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3360 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPtrc with lac operator and noneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLFYa
Plasmid#243803PurposeDropout vector for genomic integration into yeast strain LFYa. GFP is flanked by BamHI sites for easy cloning using Gibson assembly. Construct contains the attP site for the serine recombinase BxB1.DepositorArticleTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLFYalpha
Plasmid#243804PurposeDropout vector for genomic integration into yeast strain LFYalpha. GFP is flanked by BamHI sites for easy cloning using Gibson assembly. Construct contains attB site for the serine recombinase BxB1.DepositorArticleTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
p0AmpCD
Plasmid#237276PurposeEmpty vector for L0 TypeIISDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p0AmpAB
Plasmid#237274PurposeEmpty vector for L0 TypeIISDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET15b-TGP-TwinStrep
Plasmid#240251PurposeIPTG-inducible plasmid with thermostable GFP (TGP) and Twin-Strep tagsDepositorTypeEmpty backboneTags10x HIS, Thrombin, Twin-Strep, and thermostable G…ExpressionBacterialPromoterT7Available SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAD24-TGP-TwinStrep
Plasmid#240249PurposeArabinose-inducible plasmid with thermostable GFP (TGP) and Twin-Strep tagsDepositorTypeEmpty backboneTags10x HIS, Thrombin, Twin-Strep, and thermostable G…ExpressionBacterialPromoteraraBADAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
mAID(KR)–GFP NB(KR)
Plasmid#232298PurposeKR GFP nanobody adaptorDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1551
Plasmid#226498PurposepMOBK360_StandVKL: Standard Vector (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1552
Plasmid#226499PurposepMOBC360_StandVC: Standard Vector (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1423
Plasmid#221559PurposePlasmid designed to assay the site-selective methylation protection approach using the non-switchable methylasesDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tol2-mfap4-BFP
Plasmid#232188Purposemacrophage-specific promoter driving BFP in a Tol2 backbone for expression in zebrafishDepositorInsertBFP
UseZebrafish expressionPromotermfap4Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
psLIB EF1alpha
Plasmid#229954PurposebigMamAct is evolution of biGBac for mammalian cells. Has empty EF1alpha-driven cassette; users should clone gene of interest into shuttle plasmid prior to multi-assembly step by Gibson cloningDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only